Partial lateralization of the nasopalatine nerve at the incisive foramen for ridge augmentation in the anterior maxilla prior to placement of dental implants: a retrospective case series evaluating self-reported data and neurosensory testing

The objective of this study was to assess implant therapy after a staged guided bone regeneration procedure in the anterior maxilla by lateralization of the nasopalatine nerve and vessel bundle. Neurosensory function following augmentative procedures and implant placement, assessed using a standardized questionnaire and clinical examination, were the primary outcome variables measured. This retrospective study included patients with a bone defect in the anterior maxilla in need of horizontal and/or vertical ridge augmentation prior to dental implant placement. The surgical sites were allowed to heal for at least 6 months before placement of dental implants. All patients received fixed implant-supported restorations and entered into a tightly scheduled maintenance program. In addition to the maintenance program, patients were recalled for a clinical examination and to fill out a questionnaire to assess any changes in the neurosensory function of the nasopalatine nerve at least 6 months after function. Twenty patients were included in the study from February 2001 to December 2010. They received a total of 51 implants after augmentation of the alveolar crest and lateralization of the nasopalatine nerve. The follow-up examination for questionnaire and neurosensory assessment was scheduled after a mean period of 4.18 years of function. None of the patients examined reported any pain, they did not have less or an altered sensation, and they did not experience a "foreign body" feeling in the area of surgery. Overall, 6 patients out of 20 (30%) showed palatal sensibility alterations of the soft tissues in the region of the maxillary canines and incisors resulting in a risk for a neurosensory change of 0.45 mucosal teeth regions per patient after ridge augmentation with lateralization of the nasopalatine nerve. Regeneration of bone defects in the anterior maxilla by horizontal and/or vertical ridge augmentation and lateralization of the nasopalatine nerve prior to dental implant placement is a predictable surgical technique. Whether or not there were clinically measurable impairments of neurosensory function, the patients did not report them or were not bothered by them.

Geomorphology of the Imhotep region on comet 67P/Churyumov-Gerasimenko from OSIRIS observations

Context. Since August 2014, the OSIRIS Narrow Angle Camera (NAC) onboard the Rosetta spacecraft has acquired high spatial resolution images of the nucleus of comet 67P/Churyumov-Gerasimenko, down to the decimeter scale. This paper focuses on the Imhotep region, located on the largest lobe of the nucleus, near the equator. Aims. We map, inventory, and describe the geomorphology of the Imhotep region. We propose and discuss some processes to explain the formation and ongoing evolution of this region. Methods. We used OSIRIS NAC images, gravitational heights and slopes, and digital terrain models to map and measure the morphologies of Imhotep. Results. The Imhotep region presents a wide variety of terrains and morphologies: smooth and rocky terrains, bright areas, linear features, roundish features, and boulders. Gravity processes such as mass wasting and collapse play a significant role in the geomorphological evolution of this region. Cometary processes initiate erosion and are responsible for the formation of degassing conduits that are revealed by elevated roundish features on the surface. We also propose a scenario for the formation and evolution of the Imhotep region; this implies the presence of large primordial voids inside the nucleus, resulting from its formation process.

A multinational case-control study on childhood brain tumours, anthropogenic factors, birth characteristics and prenatal exposures: A validation of interview data.

Little is known about the aetiology of childhood brain tumours. We investigated anthropometric factors (birth weight, length, maternal age), birth characteristics (e.g. vacuum extraction, preterm delivery, birth order) and exposures during pregnancy (e.g. maternal: smoking, working, dietary supplement intake) in relation to risk of brain tumour diagnosis among 7-19 year olds. The multinational case-control study in Denmark, Sweden, Norway and Switzerland (CEFALO) included interviews with 352 (participation rate=83.2%) eligible cases and 646 (71.1%) population-based controls. Interview data were complemented with data from birth registries and validated by assessing agreement (Cohen's Kappa). We used conditional logistic regression models matched on age, sex and geographical region (adjusted for maternal age and parental education) to explore associations between birth factors and childhood brain tumour risk. Agreement between interview and birth registry data ranged from moderate (Kappa=0.54; worked during pregnancy) to almost perfect (Kappa=0.98; birth weight). Neither anthropogenic factors nor birth characteristics were associated with childhood brain tumour risk. Maternal vitamin intake during pregnancy was indicative of a protective effect (OR 0.75, 95%-CI: 0.56-1.01). No association was seen for maternal smoking during pregnancy or working during pregnancy. We found little evidence that the considered birth factors were related to brain tumour risk among children and adolescents.

POU domain transcription factor Brn3b is critical for the normal development and survival of retinal ganglion cells

The POU domain transcription factor Brn3b/POU4F2 plays a critical role regulating gene expression in mouse retinal ganglion cells (RGCs). Previous investigations have shown that Brn3b is not required for initial cell fate specification or migration; however, it is essential for normal RGC differentiation. In contrast to wild type axons, the mutant neurites were phenotypically different: shorter, rougher, disorganized, and poorly fasciculated. Wild type axons stained intensely with axon specific marker tau-1, while mutant projections were weakly stained and the mutant projections showed strong labeling with dendrite specific marker MAP2. Brn-3b mutant axonal projections contained more microtubules and fewer neurofilaments, a dendritic characteristic, than the wild type. The mutant neurites also exhibited significantly weaker staining of neurofilament low-molecular-weight (NF-L) in the axon when compared to the wild type, and NF-L accumulation in the neuron cell body. The absence of Brn-3b results in an inability to form normal axons and enhanced apoptosis in RGCs, suggesting that Brn-3b may control a set of genes involved in axon formation. ^ Brn3b contains several distinct sequence motifs: a glycine/serine rich region, two histidine rich regions, and a fifteen amino acid conserved sequence shared by all Brn3 family members in the N-terminus and a POU specific and POU homeodomain in the C-terminus. Brn3b activates a Luciferase reporter over 25 fold in cell culture when binding to native brn3 binding sites upstream of a minimal promoter. When fused to the Gal4 DNA Binding domain (DBD) and driven by either a strong (CMV) or weaker (pAHD) promoter, the N-terminal of Brn3b is capable of similar activation when binding to Gal4 UAS sites, indicating a presumptive activator of transcription. Both full length Brn3b or the C-terminus fused to the Gal4DBD and driven by pCMV repressed a Luciferase reporter downstream of UAS binding sites. Lower levels of expression of the fusion protein driven by pADH resulted in an alleviation of repression. This repression appears to be a limitation of this system of transcriptional analysis and a potential pitfall in conventional pCMV based transfection assays. ^

Trauma care capacity and performance in Texas: Regional comparisons

Objective. The study reviewed one year of Texas hospital discharge data and Trauma Registry data for the 22 trauma services regions in Texas to identify regional variations in capacity, process of care and clinical outcomes for trauma patients, and analyze the statistical associations among capacity, process of care, and outcomes. ^ Methods. Cross sectional study design covering one year of state-wide Texas data. Indicators of trauma capacity, trauma care processes, and clinical outcomes were defined and data were collected on each indicator. Descriptive analyses were conducted of regional variations in trauma capacity, process of care, and clinical outcomes at all trauma centers, at Level I and II trauma centers and at Level III and IV trauma centers. Multilevel regression models were performed to test the relations among trauma capacity, process of care, and outcome measures at all trauma centers, at Level I and II trauma centers and at Level III and IV trauma centers while controlling for confounders such as age, gender, race/ethnicity, injury severity, level of trauma centers and urbanization. ^ Results. Significant regional variation was found among the 22 trauma services regions across Texas in trauma capacity, process of care, and clinical outcomes. The regional trauma bed rate, the average staffed bed per 100,000 varied significantly by trauma service region. Pre-hospital trauma care processes were significantly variable by region---EMS time, transfer time, and triage. Clinical outcomes including mortality, hospital and intensive care unit length of stay, and hospital charges also varied significantly by region. In multilevel regression analysis, the average trauma bed rate was significantly related to trauma care processes including ambulance delivery time, transfer time, and triage after controlling for age, gender, race/ethnicity, injury severity, level of trauma centers, and urbanization at all trauma centers. Transfer time only among processes of care was significant with the average trauma bed rate by region at Level III and IV. Also trauma mortality only among outcomes measures was significantly associated with the average trauma bed rate by region at all trauma centers. Hospital charges only among outcomes measures were statistically related to trauma bed rate at Level I and II trauma centers. The effect of confounders on processes and outcomes such as age, gender, race/ethnicity, injury severity, and urbanization was found significantly variable by level of trauma centers. ^ Conclusions. Regional variation in trauma capacity, process, and outcomes in Texas was extensive. Trauma capacity, age, gender, race/ethnicity, injury severity, level of trauma centers and urbanization were significantly associated with trauma process and clinical outcomes depending on level of trauma centers. ^ Key words: regionalized trauma systems, trauma capacity, pre-hospital trauma care, process, trauma outcomes, trauma performance, evaluation measures, regional variations ^

Emergency health care assessment in the Houston-Galveston region 2002--2006

Background. Previous studies show emergency rooms to be over crowded nation wide. With growing attention to this problem, the Houston-Galveston Area Council (H-GAC) initiated a study in 2005 to assess their region's emergency health care system, and continued this effort in 2007. The purpose of this study was to examine recent changes in volume, capacity and performance in the Houston-Galveston region's emergency health care system and determine whether the system has been able to effectively respond to the residents' demands. Methods. Data were collected by the Houston-Galveston Area Council and The Abaris Group using a self-administered 2002-2006 survey completed by administrators of the region's hospitals, EMS providers, and select fire departments that provide EMS services. Data from both studies were combined and matched to examine trends. Results. Volume increased among the reporting hospitals within the Houston-Galveston region from 2002 to 2006; however, capacity remained relatively unchanged. EMS providers reported higher average off load times in 2007 compared to 2005, but the increases were not statistically significant. Hospitals reported transferring a statistically significant greater percentage of patients in 2006 than 2004. There was no statistically significant change in any of the other measures. Conclusion. These findings indicate an increase in demand for the Houston-Galveston region's emergency healthcare services with no change in supply. Additional studies within the area are needed to fully assess and evaluate the impact of these changes on system performance. ^

Bioterrorism preparedness at a hospital level in the Southwest Region of the United States -- A systematic review

Since the tragic events of September, 11 2001 the United States bioterrorism and disaster preparedness has made significant progress; yet, numerous research studies of nationwide hospital emergency response have found alarming shortcomings in surge capacity and training level of health care personnel in responding to bioterrorism incidents. The primary goals of this research were to assess hospital preparedness towards the threat of bioterrorist agents in the Southwest Region of the United States and provide recommendations for its improvement. Since little formal research has been published on the hospital preparedness of Oklahoma, Arizona, Texas and New Mexico, this research study specifically focused on the measurable factors affecting the respective states' resources and level of preparedness, such as funding, surge capacity and preparedness certification status.^ Over 300 citations of peer-reviewed articles and 17 Web sites were reviewed, of which 57 reports met inclusion criteria. The results of the systematic review highlighted key gaps in the existing literature and the key targets for future research, as well as identified strengths and weaknesses of the hospital preparedness in the Southwest states compared to the national average. ^ Based on the conducted research, currently, the Southwest states hospital systems are unable fully meet presidential preparedness mandates for emergency and disaster care: the staffed beds to 1,000 population value fluctuated around 1,5 across the states; funding for the hospital preparedness lags behind hospital costs by millions of dollars; and public health-hospital partnership in bioterrorism preparedness is quite weak as evident in lack of joint exercises and training. However, significant steps towards it are being made, including on-going hospital preparedness certification by the Joint Commission of Health Organization. Variations in preparedness levels among states signify that geographic location might determine a hospital level of bioterrorism preparedness as well, tending to favor bigger states such as Texas.^ Suggested recommendations on improvement of the hospital bioterrorism preparedness are consistent with the existing literature and include establishment and maintenance of solid partnerships between hospitals and public health agencies, conduction of joint exercises and drills for the health care personnel and key partners, improved state and federal funding specific to bioterrorism preparedness objectives, as well as on-going training of the clinical personnel on recognition of the bioterrorism agents.^

An examination of the cross-cultural reliability and construct validity of a measure of loneliness

Loneliness is a pervasive, rather common experience in American culture, particularly notable among adolescents. However, the phenomenon is not well documented in the cross-cultural psychiatric literature. For psychiatric epidemiology to encompass a wide array of psychopathologic phenomena, it is important to develop useful measures to characterize and classify both non-clinical and clinical dysfunction in diverse subgroups and cultures.^ The goal of this research was to examine the cross-cultural reliability and construct validity of a scale designed to measure loneliness. The Roberts Loneliness Scale (RLS-8) was administered to 4,060 adolescents ages 10-19 years enrolled in high schools along either side of the Texas-Tamaulipas border region between the U.S. and Mexico. Data collected in 1988 from a study focusing on substance use and psychological distress among adolescents in these regions were used to examine the operating characteristics of the RLS-8. A sample stratified by nationality and language, age, gender, and grade was used for analysis.^ Results indicated that in general the RLS-8 has moderate reliability in the U.S. sample, but not in the Mexican sample. Validity analyses demonstrated that there was evidence for convergent validity of the RLS-8 in the U.S. sample, but none in the Mexican sample. Discriminant validity of the measures in neither sample could be established. Based on the factor structure of the RLS-8, two subscales were created and analyzed for construct validity. Evidence for convergent validity was established for both subscales in both national samples. However, the discriminant validity of the measure remains unsubstantiated in both national samples. Also, the dimensionality of the scale is unresolved.^ One primary goal for future cross-cultural research would be to develop and test better defined culture-specific models of loneliness within the two cultures. From such scientific endeavor, measures of loneliness can be developed or reconstructed to classify the phenomenon in the same manner across cultures. Since estimates of prevalence and incidence are contingent upon reliable and valid screening or diagnostic measures, this objective would serve as an important foundation for future psychiatric epidemiologic inquiry into loneliness. ^

NOVEL PHANTOMS AND POST-PROCESSING FOR DIFFUSION SPECTRUM IMAGING

High Angular Resolution Diffusion Imaging (HARDI) techniques, including Diffusion Spectrum Imaging (DSI), have been proposed to resolve crossing and other complex fiber architecture in the human brain white matter. In these methods, directional information of diffusion is inferred from the peaks in the orientation distribution function (ODF). Extensive studies using histology on macaque brain, cat cerebellum, rat hippocampus and optic tracts, and bovine tongue are qualitatively in agreement with the DSI-derived ODFs and tractography. However, there are only two studies in the literature which validated the DSI results using physical phantoms and both these studies were not performed on a clinical MRI scanner. Also, the limited studies which optimized DSI in a clinical setting, did not involve a comparison against physical phantoms. Finally, there is lack of consensus on the necessary pre- and post-processing steps in DSI; and ground truth diffusion fiber phantoms are not yet standardized. Therefore, the aims of this dissertation were to design and construct novel diffusion phantoms, employ post-processing techniques in order to systematically validate and optimize (DSI)-derived fiber ODFs in the crossing regions on a clinical 3T MR scanner, and develop user-friendly software for DSI data reconstruction and analysis. Phantoms with a fixed crossing fiber configuration of two crossing fibers at 90° and 45° respectively along with a phantom with three crossing fibers at 60°, using novel hollow plastic capillaries and novel placeholders, were constructed. T2-weighted MRI results on these phantoms demonstrated high SNR, homogeneous signal, and absence of air bubbles. Also, a technique to deconvolve the response function of an individual peak from the overall ODF was implemented, in addition to other DSI post-processing steps. This technique greatly improved the angular resolution of the otherwise unresolvable peaks in a crossing fiber ODF. The effects of DSI acquisition parameters and SNR on the resultant angular accuracy of DSI on the clinical scanner were studied and quantified using the developed phantoms. With a high angular direction sampling and reasonable levels of SNR, quantification of a crossing region in the 90°, 45° and 60° phantoms resulted in a successful detection of angular information with mean ± SD of 86.93°±2.65°, 44.61°±1.6° and 60.03°±2.21° respectively, while simultaneously enhancing the ODFs in regions containing single fibers. For the applicability of these validated methodologies in DSI, improvement in ODFs and fiber tracking from known crossing fiber regions in normal human subjects were demonstrated; and an in-house software package in MATLAB which streamlines the data reconstruction and post-processing for DSI, with easy to use graphical user interface was developed. In conclusion, the phantoms developed in this dissertation offer a means of providing ground truth for validation of reconstruction and tractography algorithms of various diffusion models (including DSI). Also, the deconvolution methodology (when applied as an additional DSI post-processing step) significantly improved the angular accuracy of the ODFs obtained from DSI, and should be applicable to ODFs obtained from the other high angular resolution diffusion imaging techniques.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Potassium and argon concentrations and age determination of ODP Site 125-782 and 125-786

K-Ar whole-rock ages have been obtained for 30 samples from Sites 782 and 786, Ocean Drilling Program Leg 125 in the Izu-Bonin (Ogasawara) forearc region. They form a trimodal spread of ages between 9 Ma and 44 Ma and are, with a few exceptions, consistent with the inferred lithostratigraphy. The ages have been interpreted in terms of at least two distinct episodes of magmatic and/or hydrothermal activity. A group of ten samples, including the lava flows, gave an isochron age of 41.3 ± 0.5 Ma (middle-late Eocene). This is thought to represent the age of the principal magmatic development of the volcanic forearc basement, and is comparable to published ages on equivalent rocks from other parts of the forearc basement high (e.g., the Ogasawara Islands). It may be significant that this age is slightly younger than the timing of major plate reorganization in the Western Pacific at about 43 Ma. This was followed by a minor episode of intrusive magmatism at 34.6 ± 0.7 Ma (early Oligocene) which appears to have reset the ages of some of the earlier units. This event probably corresponds to the initiation of rifting of the "proto-arc" to form the Parece Vela Basin. Boninitic samples were erupted during both episodes of magmatism, the earlier being of low-Ca boninite type and the later being of medium- and high-Ca types. It is also possible that a third episode of intrusive magmatism affected the Izu-Bonin forearc region at both Sites 782 and 786 at about 17 Ma. This would be consistent with magmatic activity elsewhere in the region during the Miocene, associated with the end of active spreading in the Parece Vela Basin and the start of arc activity in the West Mariana Ridge.

(Table 2) Chemical composition of quenched glasses from the Mohns and Knipovich Ridges

The aim of this project was a petrogeochemical study of igneous rocks in the areas of the Mohns and Knipovich Ridges, both being the northern extensions of the Mid-Atlantic Ridge (MAR), using data available for quenching glass samples collected during Cruises 36 and 38 of R/V Akademic Mstislav Keldysh and during Cruise 15 of R/V Professor Logachev. Results of igneous rock studying from the Mohns and Knipovich Ridges at the background of evolution of the total North Atlantic Province, which had been identified earlier from tectonic and geophysical data, showed that igneous rocks of the Knipovich Ridge can be ranked as shallow tholeiites, primary melts of which were relatively rich in Na and Si and poor in Fe. This type of magma is characteristic of colder regions of the oceanic lithosphere. Its occurrence in the Knipovich Ridge and its potential propagation up to the Gakkel Ridge suggest that igneous rocks of this region originated under conditions of passive spreading in contrast to the MAR region in vicinity of Iceland and Azores, where substantial contribution of hotter material of a rising plume contributed to formation of the oceanic crust. The North Atlantic Ocean is the youngest province in terms of ocean-floor opening. Geologically and geophysically it is one of well studied regions of the World Ocean. Nevertheless some basic key items of its origin still remain to be clarified. In 1975 Scatler et al. proved specifics of this region manifested in growth of the gravity field, and also in relative height of the ocean floor in the region of 33-70°N, which was associated by them with rise of the hotter mantle, as compared with common regions of the Mid-Atlantic Ridge. Later this view was confirmed by character of magmatism, which differed in depth of generation and by melting degree of the resulting primary magma. Uniqueness of the North Atlantic region was also proved by the fact that this region was marked by extensive geochemical anomalies associated with Azores, Iceland, and Jan Mayen. All of these data allow to consider the northern part of the MAR (north of 33°N) as an united global geotectonic province. The Mohns and Knipovich Ridges located north of Iceland locate at the northern end of this province. This is the least known region. Therefore, new data for ridge areas of 73-77°N are needed for more complete geologic history of the Arctic Basin. The aim of this study was to carry out a complex comparison of magmatism at the Mohns and Knipovich Ridges with magmatism at large segments of the MAR northern province and to reconstruct mechanisms of primary magma formation, as well as conditions of their fractionation. This paper was based on results of studying quenched glasses, which reflect evolution of melt in the course of its formation.

Reflectance and composition of dispersed organic matter at DSDP Leg 67 Hole

Dispersed organic matter of plant origin from three sites of the Middle America Trench transect was investigated by coal petrographic methods. Samples from the slope region are rich in lipoid and inert substances. Humic matter is predominant in the trench sediments. Reflectance measurements show that the rank of the organic matter is peat, independent of the tectonic position and age of the samples in question. A slow increase of coalification with depth is observed.