949 resultados para NORMAL OCCLUSION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Endothelial function (EF) plays an important role in the onset and clinical course of atherosclerosis, although its relationship with the presence and extent of coronary artery disease (CAD) has not been well defined. We evaluated EF and the ST segment response to an exercise test in patients with a broad spectrum of CAD defined by coronary angiography. Sixty-two patients submitted to diagnostic catheterization for the evaluation of chest pain or ischemia in a provocative test were divided into three groups according to the presence and severity of atherosclerotic lesions (AL): group 1: normal coronaries (N = 19); group 2: CAD with AL <70% (N = 17); group 3: CAD with AL ≥70% (N = 26). EF was evaluated by the percentage of flow-mediated dilatation (%FMD) in the brachial artery during reactive hyperemia induced by occlusion of the forearm with a pneumatic cuff for 5 min. Fifty-four patients were subjected to an exercise test. Gender and age were not significantly correlated with %FMD. EF was markedly reduced in both groups with CAD (76.5 and 73.1% vs 31.6% in group 1) and a higher frequency of ischemic alterations in the ST segment (70.8%) was observed in the group with obstructive CAD with AL ≥70% during the exercise test. Endothelial dysfunction was observed in patients with CAD, irrespective of the severity of injury. A significantly higher frequency of ischemic alterations in the ST segment was observed in the group with obstructive CAD. EF and exercise ECG differed among the three groups and may provide complementary information for the assessment of CAD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The generation of bradykinin (BK; Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg) in blood and kallidin (Lys-BK) in tissues by the action of the kallikrein-kinin system has received little attention in non-mammalian vertebrates. In mammals, kallidin can be generated by the coronary endothelium and myocytes in response to ischemia, mediating cardioprotective events. The plasma of birds lacks two key components of the kallikrein-kinin system: the low molecular weight kininogen and a prekallikrein activator analogous to mammalian factor XII, but treatment with bovine plasma kallikrein generates ornitho-kinin [Thr6,Leu8]-BK. The possible cardioprotective effect of ornitho-kinin infusion was investigated in an anesthetized, open-chest chicken model of acute coronary occlusion. A branch of the left main coronary artery was reversibly ligated to produce ischemia followed by reperfusion, after which the degree of myocardial necrosis (infarct size as a percent of area at risk) was assessed by tetrazolium staining. The iv injection of a low dose of ornitho-kinin (4 µg/kg) reduced mean arterial pressure from 88 ± 12 to 42 ± 7 mmHg and increased heart rate from 335 ± 38 to 402 ± 45 bpm (N = 5). The size of the infarct was reduced by pretreatment with ornitho-kinin (500 µg/kg infused over a period of 5 min) from 35 ± 3 to 10 ± 2% of the area at risk. These results suggest that the physiological role of the kallikrein-kinin system is preserved in this animal model in spite of the absence of two key components, i.e., low molecular weight kininogen and factor XII.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dyslipidemia is related to the progression of atherosclerosis and is an important risk factor for acute coronary syndromes. Our objective was to determine the effect of rosuvastatin on myocardial necrosis in an experimental model of acute myocardial infarction (AMI). Male Wistar rats (8-10 weeks old, 250-350 g) were subjected to definitive occlusion of the left anterior descending coronary artery to cause AMI. Animals were divided into 6 groups of 8 to 11 rats per group: G1, normocholesterolemic diet; G2, normocholesterolemic diet and rosuvastatin (1 mg·kg-1·day-1) 30 days after AMI; G3, normocholesterolemic diet and rosuvastatin (1 mg·kg-1·day-1) 30 days before and after AMI; G4, hypercholesterolemic diet; G5, hypercholesterolemic diet and rosuvastatin (1 mg·kg-1·day-1) 30 days after AMI; G6, hypercholesterolemic diet and rosuvastatin (1 mg·kg-1·day-1) 30 days before and after AMI. Left ventricular function was determined by echocardiography and percent infarct area by histology. Fractional shortening of the left ventricle was normal at baseline and decreased significantly after AMI (P < 0.05 in all groups), being lower in G4 and G5 than in the other groups. No significant difference in fractional shortening was observed between G6 and the groups on the normocholesterolemic diet. Percent infarct area was significantly higher in G4 than in G3. No significant differences were observed in infarct area among the other groups. We conclude that a hypercholesterolemic diet resulted in reduced cardiac function after AMI, which was reversed with rosuvastatin when started 30 days before AMI. A normocholesterolemic diet associated with rosuvastatin before and after AMI prevented myocardial necrosis when compared with the hypercholesterolemic condition.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Agmatine, an endogenous polyamine and putative neuromodulator, is known to have neuroprotective effects on various neurons in the central nervous system. We determined whether or not topically administered agmatine could reduce ischemic retinal injury. Transient ocular ischemia was achieved by intraluminal occlusion of the middle cerebral artery of ddY mice (30-35 g) for 2 h, which is known to also induce occlusion of the ophthalmic artery. In the agmatine group (N = 6), a 1.0 mM agmatine-containing ophthalmic solution was administered four times daily for 2 weeks before occlusion. In the control group (N = 6), a 0.1% hyaluronic acid ophthalmic solution was instilled at the same times. At 22 h after reperfusion, the eyeballs were enucleated and the retinal sections were stained by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL). Transient ocular ischemia induced apoptosis of retinal cells in the entire retinal layer, and topically administered agmatine can significantly reduce this ischemic retinal injury. The proportion of apoptotic cells was definitely decreased (P < 0.001; Kruskal-Wallis test). Overall, we determined that topical agmatine application effectively decreases retinal damage in an in vivo ocular ischemic injury model. This implies that agmatine is a good candidate as a direct neuroprotective agent for eyes with ocular ischemic diseases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-γ) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-γ in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The intestinal lymph pathway plays an important role in the pathogenesis of organ injury following superior mesenteric artery occlusion (SMAO) shock. We hypothesized that mesenteric lymph reperfusion (MLR) is a major cause of spleen injury after SMAO shock. To test this hypothesis, SMAO shock was induced in Wistar rats by clamping the superior mesenteric artery (SMA) for 1 h, followed by reperfusion for 2 h. Similarly, MLR was performed by clamping the mesenteric lymph duct (MLD) for 1 h, followed by reperfusion for 2 h. In the MLR+SMAO group rats, both the SMA and MLD were clamped and then released for reperfusion for 2 h. SMAO shock alone elicited: 1) splenic structure injury, 2) increased levels of malondialdehyde, nitric oxide (NO), intercellular adhesion molecule-1, endotoxin, lipopolysaccharide receptor (CD14), lipopolysaccharide-binding protein, and tumor necrosis factor-α, 3) enhanced activities of NO synthase and myeloperoxidase, and 4) decreased activities of superoxide dismutase and ATPase. MLR following SMAO shock further aggravated these deleterious effects. We conclude that MLR exacerbates spleen injury caused by SMAO shock, which itself is associated with oxidative stress, excessive release of NO, recruitment of polymorphonuclear neutrophils, endotoxin translocation, and enhanced inflammatory responses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.