976 resultados para Human-lung Fibroblasts
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
We have attempted to model human metastatic disease by implanting human target organs into the immunodeficient C.B-17 scid/scid (severe combined immunodeficiency; SCID) mouse, creating SCID-hu mice. Preferential metastasis to implants of human fetal lung and human fetal bone marrow occurred after i.v. injection of human small cell lung cancer (SCLC) cells into SCID-hu mice; the homologous mouse organs were spared. Clinically more aggressive variant SCLC cells metastasized more efficiently to human fetal lung implants than did cells from classic SCLC. Metastasis of variant SCLC to human fetal bone marrow was enhanced in SCID-hu mice exposed to gamma-irradiation or to interleukin 1 alpha. These data indicate that the SCID-hu mice may provide a model in which to study species- and tissue-specific steps of the human metastatic process.
Resumo:
We have examined whether the secretion of erythropoietin (Epo) from genetically modified cells could represent an alternative to repeated injections of the recombinant hormone for treating chronic anemias responsive to Epo. Primary mouse skin fibroblasts were transduced with a retroviral vector in which the murine Epo cDNA is expressed under the control of the murine phosphoglycerate kinase promoter. "Neo-organs" containing the genetically modified fibroblasts embedded into collagen lattices were implanted into the peritoneal cavity of mice. Increased hematocrit (> 80%) and elevated serum Epo concentration (ranging from 60 to 408 milliunits/ml) were observed in recipient animals over a 10-month observation period. Hematocrit values measured in recipient mice varied according to the number of implanted Epo-secreting fibroblasts (ranging from 2.5 to 20 x 10(6)). The implantation of neo-organs containing Epo-secreting fibroblasts appeared, therefore, as a convenient method to achieve permanent in vivo delivery of the hormone. We estimated that the biological efficacy of the approach may be relevant for the treatment of human hemoglobinopathies.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Retinitis pigmentosa (RP) represents a genetically heterogeneous group of retinal dystrophies affecting mainly the rod photoreceptors and in some instances also the retinal pigment epithelium (RPE) cells of the retina. Clinical symptoms and disease progression leading to moderate to severe loss of vision are well established and despite significant progress in the identification of causative genes, the disease pathology remains unclear. Lack of this understanding has so far hindered development of effective therapies. Here we report successful generation of human induced pluripotent stem cells (iPSC) from skin fibroblasts of a patient harboring a novel Ser331Cysfs*5 mutation in the MERTK gene. The patient was diagnosed with an early onset and severe form of autosomal recessive RP (arRP). Upon differentiation of these iPSC towards RPE, patient-specific RPE cells exhibited defective phagocytosis, a characteristic phenotype of MERTK deficiency observed in human patients and animal models. Thus we have created a faithful cellular model of arRP incorporating the human genetic background which will allow us to investigate in detail the disease mechanism, explore screening of a variety of therapeutic compounds/reagents and design either combined cell and gene- based therapies or independent approaches.
Resumo:
Shipping list no.: 87-541-P.
Resumo:
"August 1983."
Resumo:
Thesis (Master's)--University of Washington, 2016-06
Resumo:
Sulfate plays an essential role during growth, development, bone/cartilage formation, and cellular metabolism. In this study, we have isolated the human sulfate anion transporter cDNA (hsat-1; SCL26A1) and gene (SAT1), determined its protein function in Xenopus oocytes and characterized SAT1 promoter activity in mammalian renal cell lines. hsat-1 encodes a protein of 75 kDa, with 12 putative transmembrane domains, that induces sulfate, chloride, and oxalate transport in Xenopus oocytes. hsat-1 mRNA is expressed most abundantly in the kidney and liver, with lower levels in the pancreas, testis, brain, small intestine, colon, and lung. The SAT1 gene is comprised of four exons stretching 6 kb in length, with an alternative splice site formed from an optional exon. SAT1 5' flanking region led to promoter activity in renal OK and LLC-PK1 cells. Using SAT1 5' flanking region truncations, the first 135 bp was shown to be sufficient for basal promoter activity. Mutation of the activator protein-1 (AP-1) site at position 252 in the SAT1 promoter led to loss of transcriptional activity, suggesting its requirement for SAT1 basal expression. This study represents the first functional characterization of the human SAT1 gene and protein encoded by the anion transporter hsat-1.
Resumo:
Immunotherapy strategies aimed at increasing human Valpha24(+)Vbeta11(+) natural killer T (NKT) cell numbers are currently a major focus. To provide further information towards the goal of NKT cell-based immunotherapy, we assessed the effects of age, cancer status and prior anticancer treatment on NKT cell numbers and their expansion capacity following alpha-galactosylceramide (alpha-GalCer) stimulation. The percentage and absolute number of peripheral blood NKT cells was assessed in 40 healthy donors and 109 solid cancer patients ( colorectal ( n = 33), breast ( n = 10), melanoma ( n = 17), lung ( n = 8), renal cell carcinoma ( n = 10), other cancers ( n = 31)). Responsiveness to alpha-GalCer stimulation was also assessed in 28 of the cancer patients and 37 of the healthy donors. Natural killer T cell numbers were significantly reduced in melanoma and breast cancer patients. While NKT numbers decreased with age in healthy donors, NKT cells were decreased in these cancer subgroups despite age and sex adjustments. Prior radiation treatment was shown to contribute to the observed reduction in melanoma patients. Although cancer patient NKT cells were significantly less responsive to alpha-GalCer stimulation, they remained capable of substantial expansion. Natural killer T cells are therefore modulated by age, malignancy and prior anticancer treatment; however, cancer patient NKT cells remain capable of responding to alpha-GalCer-based immenotherapies.
Resumo:
Objectives:The aim of this study was to assess the biological rationale for the use of platelet-rich plasma (PRP) by evaluating the effect of different concentrations of PRP on osteoblasts (OB) and fibroblasts (FB) function in vitro. Materials and methods:PRP was obtained from volunteer donors using standard protocols. Primary human cultures of oral FBs and OBs were exposed to both activated and non-activated plasma as well as various concentrations of PRP (2.5 x, 3.5 x and max (4.2-5.5 x)). Cell proliferation was evaluated after 24 and 72 h using an MTT proliferation assay. Production of osteocalcin (OCN), osteoprotegerin (OPG) and transforming growth factor beta 1 (TGF-beta 1) was evaluated in OB after 24 and 72 h. Statistical analysis was performed using one-way ANOVA. Results:PRP-stimulated cell proliferation in both OBs and FBs. The effect of different PRP concentrations on cell proliferation was most notable at 72 h. The maximum effect was achieved with a concentration of 2.5 x, with higher concentrations resulting in a reduction of cell proliferation. Upregulation of OCN levels and downregulation of OPG levels were noted with increasing PRP concentrations at both 24 and 72 h. TGF-beta 1 levels were stimulated by increasing concentrations of PRP, with the increased levels being maintained at 72 h. Conclusions:PRP preparations exert a dose-specific effect on oral FBs and OBs. Optimal results were observed at a platelet concentration of 2.5 x, which was approximately half of the maximal concentrate that could be obtained. Increased concentrations resulted in a reduction in proliferation and a suboptimal effect on OB function. Hence, different PRP concentrations may have an impact on the results that can be obtained in vivo.
Resumo:
Epigenetics is the study of heritable changes in gene expression that occur without changes in DNA sequence. It has a role in determining when and where a gene is expressed during development. Perhaps the most well known epigenetic mechanism is DNA methylation whereby cytosines at position 5 in CpG dinucleotides are methylated. Histone modification is another form of epigenetic control, which is quite complex and diverse. Histones and DNA make up the nucleosome which is the structural unit of chromatin which are involved in packaging DNA. Apart from the crucial role epigenetics plays in embryonic development, transcription, chromatin structure, X chromosome inactivation and genomic imprinting, its role in an increasing number of human diseases is more and more recognized. These diseases include cancer, and lung cancer in particular has been increasingly studied for the potential biological role of epigenetic changes with the promise of better and novel diagnostic and therapeutic tools.
Resumo:
Lysosomal acid lipase (LAL) hydrolyzes cholesteryl esters and triglycerides to generate free fatty acids and cholesterol in the cell. The downstream metabolites of these compounds serve as hormonal ligands for nuclear receptors and transcription factors. Genetic ablation of the lal gene in the mouse caused malformation of macrophages and inflammation-triggered multiple pathogenic phenotypes in multiple organs. To assess the relationship between macro phages and lal(-/-) pathogenic phenotypes, a macrophage-specific doxycycline-inducible transgenic system was generated to induce human LAL (hLAL) expression in the lal(-/-) genetic background under control of the 7.2-kb c-fins promoter/intron2 regulatory sequence. Doxycycline-induced hLAL expression in macrophages significantly ameliorated aberrant gene expression, inflammatory cell (neutrophil) influx, and pathogenesis in multiple organs. These studies strongly support that neutral lipid metabolism in macrophages contributes to organ inflammation and pathogenesis.
Resumo:
TSLC1 (tumor suppressor in lung cancer-1, IGSF4) encodes a member of the immunoglobulin superfamily molecules, which is involved in cell-cell adhesion. TSLC1 is connected to the actin cytoskeleton by DAL-1 (differentially expressed in adenocarcinoma of the lung-1, EPB41L3) and it directly associates with MPP3, one of the human homologues of a Drosophila tumor suppressor gene, Discs large. Recent data suggest that aberrant promoter methylation is important for TSLC1 inactivation in lung carcinomas. However, little is known about the other two genes in this cascade, DAL-1 and MPP3. Thus, we investigated the expression and methylation patterns of these genes in lung cancer cell lines, primary lung carcinomas and nonmalignant lung tissue samples. By reverse transcription-polymerase chain reaction, loss of TSLC1 expression was observed in seven of 16 (44%) non-small-cell lung cancer (NSCLC) cell lines and in one of 11 (9%) small-cell lung cancer (SCLC) cell lines, while loss of DAL- 1 expression was seen in 14 of 16 (87%) NSCLC cell lines and in four of 11 (36%) SCLC cell lines. By contrast, MPP3 expression was found in all tumor cell lines analysed. Similar results were obtained by microarray analysis. TSLC1 methylation was seen in 13 of 39 (33%) NSC LC cell lines, in one of 11 (9%) SCLC cell lines and in 100 of 268 (37%) primary NSCLCs. DAL-1 methylation was observed in 17 of 39 (44%) NSCLC cell lines, in three of 11 (27%) SCLC cell lines and in 147 of 268 (55%) primary NSCLCs. In tumors of NSCLC patients with stage II-III disease, DAL-1 methylation was seen at a statistically significant higher frequency compared to tumors of patients with stage I disease. A significant correlation between loss of expression and methylation of the genes in lung cancer cell lines was found. Overall, 65% of primary NSCLCs had either TSLC1 or DAL-1 methylated. Methylation of one of these genes was detected in 59% of NSCLC cell lines; however, in SCLC cell lines, methylation was much less frequently observed. The majority of nonmalignant lung tissue samples was not TSLC1 and DAL-1 methylated. Re-expression of TSLC1 and DAL-1 was seen after treatment of lung cancer cell lines with 5-aza-2$-deoxy-cytidine. Our results suggest that methylation of TSLC1 and/or DAL-1, leading to loss of their expression, is an important event in the pathogenesis of NSCLC.
Resumo:
Chemotherapy in the last century was characterized by cytotoxic drugs that did not discriminate between cancerous and normal cell types and were consequently accompanied by toxic side effects that were often dose limiting. The ability of differentiating agents to selectively kill cancer cells or transform them to a nonproliferating or normal phenotype could lead to cell- and tissue-specific drugs without the side effects of current cancer chemotherapeutics. This may be possible for a new generation of histone deacetylase inhibitors derived from amino acids. Structure-activity relationships are now reported for 43 compounds derived from 2-aminosuberic acid that kill a range of cancer cells, 26 being potent cytotoxins against MM96L melanoma cells (IC50 20 nM-1 mu M), while 17 were between 5- and 60-fold more selective in killing MM96L melanoma cells versus normal (neonatal foreskin fibroblasts, NFF) cells. This represents a 10- to 100-fold increase in potency and up to a 10-fold higher selectivity over previously reported compounds derived from cysteine (J. Med. Chem. 2004, 47, 2984). Selectivity is also an underestimate, because the normal cells, NFF, are rarely all killed by the drugs that also induce selective blockade of the cell cycle for normal but not cancer cells. Selected compounds were tested against a panel of human cancer cell lines (melanomas, prostate, breast, ovarian, cervical, lung, and colon) and found to be both selective and potent cytotoxins (IC50 20 nM-1 mu M). Compounds in this class typically inhibit human histone deacetylases, as evidenced by hyperacetylation of histones in both normal and cancer cells, induce expression of p21, and differentiate surviving cancer cells to a nonproliferating phenotype. These compounds may be valuable leads for the development of new chemotherapeutic agents.