965 resultados para Human Dna
Resumo:
Dietary isoflavones from soy are suggested to protect endothelial cells from damaging effects of endothelial stressors and thereby to prevent atherosclerosis. In search of the molecular targets of isoflavone action, we analyzed the effects of the major soy isoflavone, genistein, on changes in protein expression levels induced by the endothelial stressor homocysteine (Hcy) in EA.hy 926 endothelial cells. Proteins from cells exposed for 24 h to 25 mu M Hcy alone or in combination with 2.5 mu M genistein were separated by two-dimensional gel electrophoresis and those with altered spot intensities were identified by peptide mass fingerprinting, Genistein reversed Hcy-induced changes of proteins involved in metabolism, detoxification, and gene regulation: and some of those effects can be linked functionally to the antiatherosclerotic properties of the soy isoflavone. Alterations of steady-state levels of cytoskeletal proteins by genistein suggested an effect oil apoptosis. As a matter of fact genistein caused inhibition of Hcy-mediated apoptotic cell death as indicated by inhibition of DNA fragmentation and chromatin condensation. In conclusion, proteome analysis allows the rapid identification of cellular target proteins of genistein action in endothelial cells exposed to the endothelial stressor Hcy and therefore enables the identification of molecular pathways of its antiatherosclerotic action
Resumo:
Phenotypic and phylogenetic studies were performed on four isolates of an unidentified gram-negative, microaerotolerant, non-spore-forming, rod-shaped bacterium isolated from the feces of children. The unknown organism was bile resistant and produced acetic acid as the major end product of metabolism of peptides and carbohydrates. It possessed a low DNA G + C content of 31 mol %. Comparative 16S rRNA gene sequencing demonstrated that the four isolates were phylogenetically identical (100% 16S rRNA sequence similarity) and represent a hitherto unknown sub-line within the genus Cetobacterium. The novel bacterium displayed approximately 5% sequence divergence with Cetobacterium ceti, and can be readily distinguished from the latter by physiological and biochemical criteria. Based on phylogenetic and phenotypic evidence, it is proposed that the unknown fecal bacterium be classified in the genus Cetobacterium, as Cetobacterium somerae sp. nov. The proposed type strain of Cetobacterium somerae is WAL 14325(T) (ATCC BAA-474(T) = CCUG 46254T).
Resumo:
Current intakes of very long chain omega-3 fatty acids, eicosapentaenoic acid (EPA), and docosahexaenoic acid (DNA) are low in most individuals living in Western countries. A good natural source of these fatty acids is seafood, especially oily fish. Fish oil capsules contain these fatty acids too. Very long chain w-3 fatty acids are readily incorporated from capsules into transport, functional, and storage pools. This incorporation is dose-dependent and follows a kinetic pattern that is characteristic for each pool. At sufficient levels of incorporation, EPA and DHA influence the physical nature of cell membranes and membrane protein-mediated responses, eicosanoid generation, cell signaling and gene expression in many different cell types. Through these mechanisms, EPA and DHA influence cell and tissue physiology, and the way cells and tissues respond to external signals. In most cases, the effects seen are compatible with improvements in disease biomarker profiles or in health-related outcomes. As a result, very long chain omega-3 fatty acids play a role in achieving optimal health and in protection against disease. Long chain omega-3 fatty acids protect against cardiovascular morbidity and mortality, and might be beneficial in rheumatoid arthritis, inflammatory bowel diseases, childhood learning, and behavior, and adult psychiatric and neurodegenerative illnesses. DHA has an important structural role in the eye and brain, and its supply early in life is known to be of vital importance. On the basis of the recognized health improvements brought about by long chain omega-3 fatty acids, recommendations have been made to increase their intake. (C) 2009 International Union of Biochemistry and Molecular Biology, Inc. Volume 35, Number 3, May/June 2009, Pages 266-272. E-mail: pcc@soton.ac.uk
Resumo:
Objective: In recent years the use of anthraquinone laxatives, in particular senna, has been associated with damage to the intestinal epithelial layer and an increased risk of developing colorectal cancer. In the present study we evaluated the cytotoxicity of rhein, the active metabolite of senna, on human colon adenocarcinoma cells (Caco-2) and its effect on cell proliferation. Methods: Cytotoxicity studies were performed using MTT, NR and TEER assays whereas 3H-thymidine incorporation and western blot analysis were used to evaluate the effect of rhein on cell proliferation. Moreover, for genoprotection studies Comet assay and oxidative biomarkers measurement (malondialdehyde and reactive oxygen species) were used. Results: Rhein (0.1-10μg/ml) had no significant cytotoxic effect on proliferating and differentiated Caco-2 cells. Rhein (0.1 and 1 μg/ml) significantly reduced cell proliferation as well as MAP kinase activation; by contrast, at the high concentration (10μg/ml) rhein significantly increased cell proliferation and ERK phosphorylation. Moreover, rhein (0.1-10μg/ml) (i) did not adversely affect the integrity of tight junctions and hence epithelial barrier function, (ii) did not induce DNA damage rather it was able to reduce H2O2-induced DNA damage and (iii) significantly inhibited the increase in malondialdehyde and ROS levels induced by H2O2/Fe2+. Conclusions: Rhein, was devoid of cytotoxic and genotoxic effects in colon adenocarcinoma cells. Moreover, at concentrations present in the colon after a human therapeutic dosage of senna, rhein inhibited cell proliferation via a mechanism which seems to involve directly the MAP kinase pathway. Finally, rhein prevents the DNA damage probably via an anti-oxidant mechanism.
Resumo:
Mitochondrial DNA (mtDNA) mutations are an important cause of genetic disease and have been proposed to play a role in the ageing process. Quantification of total mtDNA mutation load in ageing tissues is difficult as mutational events are rare in a background of wild-type molecules, and detection of individual mutated molecules is beyond the sensitivity of most sequencing based techniques. The methods currently most commonly used to document the incidence of mtDNA point mutations in ageing include post-PCR cloning, single-molecule PCR and the random mutation capture assay. The mtDNA mutation load obtained by these different techniques varies by orders of magnitude, but direct comparison of the three techniques on the same ageing human tissue has not been performed. We assess the procedures and practicalities involved in each of these three assays and discuss the results obtained by investigation of mutation loads in colonic mucosal biopsies from ten human subjects.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
As an obligatory parasite of humans, the body louse (Pediculus humanus humanus) is an important vector for human diseases, including epidemic typhus, relapsing fever, and trench fever. Here, we present genome sequences of the body louse and its primary bacterial endosymbiont Candidatus Riesia pediculicola. The body louse has the smallest known insect genome, spanning 108 Mb. Despite its status as an obligate parasite, it retains a remarkably complete basal insect repertoire of 10,773 protein-coding genes and 57 microRNAs. Representing hemimetabolous insects, the genome of the body louse thus provides a reference for studies of holometabolous insects. Compared with other insect genomes, the body louse genome contains significantly fewer genes associated with environmental sensing and response, including odorant and gustatory receptors and detoxifying enzymes. The unique architecture of the 18 minicircular mitochondrial chromosomes of the body louse may be linked to the loss of the gene encoding the mitochondrial single-stranded DNA binding protein. The genome of the obligatory louse endosymbiont Candidatus Riesia pediculicola encodes less than 600 genes on a short, linear chromosome and a circular plasmid. The plasmid harbors a unique arrangement of genes required for the synthesis of pantothenate, an essential vitamin deficient in the louse diet. The human body louse, its primary endosymbiont, and the bacterial pathogens that it vectors all possess genomes reduced in size compared with their free-living close relatives. Thus, the body louse genome project offers unique information and tools to use in advancing understanding of coevolution among vectors, symbionts, and pathogens.
Resumo:
Cross-contamination between cell lines is a longstanding and frequent cause of scientific misrepresentation. Estimates from national testing services indicate that up to 36% of cell lines are of a different origin or species to that claimed. To test a standard method of cell line authentication, 253 human cell lines from banks and research institutes worldwide were analyzed by short tandem repeat profiling. The short tandem repeat profile is a simple numerical code that is reproducible between laboratories, is inexpensive, and can provide an international reference standard for every cell line. If DNA profiling of cell lines is accepted and demanded internationally, scientific misrepresentation because of cross-contamination can be largely eliminated.
Resumo:
Red meat consumption is associated with an increased colorectal cancer (CRC) risk, which may be due to an increased endogenous formation of genotoxic N-nitroso compounds (NOCs). To assess the impact of red meat consumption on potential risk factors of CRC, we investigated the effect of a 7-day dietary red meat intervention in human subjects on endogenous NOC formation and fecal water genotoxicity in relation to genome-wide transcriptomic changes induced in colonic tissue. The intervention showed no effect on fecal NOC excretion but fecal water genotoxicity significantly increased in response to red meat intake. Colonic inflammation caused by inflammatory bowel disease, which has been suggested to stimulate endogenous nitrosation, did not influence fecal NOC excretion or fecal water genotoxicity. Transcriptomic analyses revealed that genes significantly correlating with the increase in fecal water genotoxicity were involved in biological pathways indicative of genotoxic effects, including modifications in DNA damage repair, cell cycle, and apoptosis pathways. Moreover, WNT signaling and nucleosome remodeling pathways were modulated which are implicated in human CRC development. We conclude that the gene expression changes identified in this study corroborate the genotoxic potential of diets high in red meat and point towards a potentially increased CRC risk in humans.
Resumo:
Mitochondrial DNA (mtDNA) mutations are an important cause of genetic disease and have been proposed to play a role in the ageing process. Quantification of total mtDNA mutation load in ageing tissues is difficult as mutational events are rare in a background of wild-type molecules, and detection of individual mutated molecules is beyond the sensitivity of most sequencing based techniques. The methods currently most commonly used to document the incidence of mtDNA point mutations in ageing include post-PCR cloning, single-molecule PCR and the random mutation capture assay. The mtDNA mutation load obtained by these different techniques varies by orders of magnitude, but direct comparison of the three techniques on the same ageing human tissue has not been performed. We assess the procedures and practicalities involved in each of these three assays and discuss the results obtained by investigation of mutation loads in colonic mucosal biopsies from ten human subjects.
Resumo:
The presence of resident Langerhans cells (LCs) in the epidermis makes the skin an attractive target for DNA vaccination. However, reliable animal models for cutaneous vaccination studies are limited. We demonstrate an ex vivo human skin model for cutaneous DNA vaccination which can potentially bridge the gap between pre-clinical in vivo animal models and clinical studies. Cutaneous transgene expression was utilised to demonstrate epidermal tissue viability in culture. LC response to the culture environment was monitored by immunohistochemistry. Full-thickness and split-thickness skin remained genetically viable in culture for at least 72 h in both phosphate-buffered saline (PBS) and full organ culture medium (OCM). The epidermis of explants cultured in OCM remained morphologically intact throughout the culture duration. LCs in full-thickness skin exhibited a delayed response (reduction in cell number and increase in cell size) to the culture conditions compared with split-thickness skin, whose response was immediate. In conclusion, excised human skin can be cultured for a minimum of 72 h for analysis of gene expression and immune cell activation. However, the use of split-thickness skin for vaccine formulation studies may not be appropriate because of the nature of the activation. Full-thickness skin explants are a more suitable model to assess cutaneous vaccination ex vivo.
Resumo:
The combination of virulence gene and antimicrobial resistance gene typing using DNA arrays is a recently developed genomics-based approach to bacterial molecular epidemiology. We have now applied this technology to 523 Salmonella enterica subsp. enterica strains collected from various host sources and public health and veterinary institutes across nine European countries. The strain set included the five predominant Salmonella serovars isolated in Europe (Enteritidis, Typhimurium, Infantis, Virchow, and Hadar). Initially, these strains were screened for 10 potential virulence factors (avrA, ssaQ, mgtC, siiD, sopB, gipA, sodC1, sopE1, spvC, and bcfC) by polymerase chain reaction. The results indicated that only 14 profiles comprising these genes (virulotypes) were observed throughout Europe. Moreover, most of these virulotypes were restricted to only one (n = 9) or two (n = 4) serovars. The data also indicated that the virulotype did not vary significantly with host source or geographical location. Subsequently, a representative subset of 77 strains was investigated using a microarray designed to detect 102 virulence and 49 resistance determinants. The results confirmed and extended the previous observations using the virulo-polymerase chain reaction screen. Strains belonging to the same serovar grouped together, indicating that the broader virulence-associated gene complement corresponded with the serovar. There were, however, some differences in the virulence gene profiles between strains belonging to an individual serovar. This variation occurred primarily within those virulence genes that were prophage encoded, in fimbrial clusters or in the virulence plasmid. It seems likely that such changes enable Salmonella to adapt to different environmental conditions, which might be reflected in serovar-specific ecology. In this strain subset a number of resistance genes were detected and were serovar restricted to a varying degree. Once again the profiles of those genes encoding resistance were similar or the same for each serovar in all hosts and countries investigated.
Resumo:
Although it is known to be a rich source of the putative anti-cancer chemicals isothiocyanates, watercress has not been extensively studied for its cancer preventing properties. The aim of this study was to investigate the potential chemoprotective effects of crude watercress extract toward three important stages in the carcinogenic process, namely initiation, proliferation, and metastasis (invasion) using established in vitro models. HT29 cells were used to investigate the protective effects of the extract on DNA damage and the cell cycle. The extract was not genotoxic but inhibited DNA damage induced by two of the three genotoxins used, namely hydrogen peroxide and fecal water, indicating the potential to inhibit initiation. It also caused an accumulation of cells in the S phase of the cell cycle indicating (possible) cell cycle delay at this stage. The extract was shown to significantly inhibit invasion of HT115 cells through matrigel. Component analysis was also carried out in an attempt to determine the major phytochemicals present in both watercress leaves and the crude extract. In conclusion, the watercress extract proved to be significantly protective against the three stages of the carcinogenesis process investigated.
Resumo:
A polymerase chain reaction (PCR) assay was developed to detect Chlamydia psittaci DNA in faeces and tissue samples from avian species. Primers were designed to amplify a 264 bp product derived from part of the 5' non-translated region and part of the coding region of the ompA gene which encodes the major outer membrane protein. Amplified sequences were confirmed by Southern hybridization using an internal probe. The sensitivity of the combined assay was found to be between 60 to 600 fg of chlamydial DNA (approximately 6 to 60 genome copies). The specificity of the assay was confirmed since PCR product was not obtained from samples containing several serotypes of C. trachomatis, strains of C. pneumoniae, the type strain of C. pecorum, nor from samples containing microorganisms commonly found in the avian gut flora. In this study, 404 avian faeces and 141 avian tissue samples received by the Central Veterinary Laboratory over a 6 month period were analysed by PCR, antigen detection ELISA and where possible, cell culture isolation. PCR performed favourably compared with ELISA and cell culture, or with ELISA alone. The PCR assay was especially suited to the detection of C. psittaci DNA in avian faeces samples. The test was also useful when applied to tissue samples from small contact birds associated with a case of human psittacosis where ELISA results were negative and chlamydial isolation was a less favourable method due to the need for rapid diagnosis.
Resumo:
With the exceptions of the bifidobacteria, propionibacteria and coriobacteria, the Actinobacteria associated with the human gastrointestinal tract have received little attention. This has been due to the seeming absence of these bacteria from most clone libraries. In addition, many of these bacteria have fastidious growth and atmospheric requirements. A recent cultivation-based study has shown that the Actinobacteria of the human gut may be more diverse than previously thought. The aim of this study was to develop a denaturing gradient gel electrophoresis (DGGE) approach for characterizing Actinobacteria present in faecal samples. Amount of DNA added to the Actinobacteria-specific PCR used to generate strong PCR products of equal intenstity from faecal samples of five infants, nine adults and eight elderly adults was anti-correlated with counts of bacteria obtained using fluorescence in situ hybridization probe HGC69A. A nested PCR using Actinobacteria-specific and universal PCR-DGGE primers was used to generate profiles for the Actinobacteria. Cloning of sequences from the DGGE bands confirmed the specificity of the Actinobacteria-specific primers. In addition to members of the genus Bifidobacterium, species belonging to the genera Propionibacterium, Microbacterium, Brevibacterium, Actinomyces and Corynebacterium were found to be part of the faecal microbiota of healthy humans.