994 resultados para Clock Drawing test


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compressive strength of concrete is an important factor in the design of concrete structures and pavements. To assure the quality of the concrete placed at the project, concrete compressive cylinders are made at the jobsite. These cylinders undergo a destructive test to determine their compressive strength. However, the determination of concrete compressive strength of the concrete actually in the structure or pavement is frequently desirable. For this reason, a nondestructive test of the concrete is required. A nondestructive test of concrete compressive strength should be economical, easily performed by field personnel, and capable of producing accurate, reproducible results. The nondestructive test should be capable of detecting the extent of poor concrete in a pavement or structure due to improper handling, placement, or variations in mixing or materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cardiovascular risk assessment might be improved with the addition of emerging, new tests derived from atherosclerosis imaging, laboratory tests or functional tests. This article reviews relative risk, odds ratios, receiver-operating curves, posttest risk calculations based on likelihood ratios, the net reclassification improvement and integrated discrimination. This serves to determine whether a new test has an added clinical value on top of conventional risk testing and how this can be verified statistically. Two clinically meaningful examples serve to illustrate novel approaches. This work serves as a review and basic work for the development of new guidelines on cardiovascular risk prediction, taking into account emerging tests, to be proposed by members of the 'Taskforce on Vascular Risk Prediction' under the auspices of the Working Group 'Swiss Atherosclerosis' of the Swiss Society of Cardiology in the future.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Detection rates for adenoma and early colorectal cancer (CRC) are unsatisfactory due to low compliance towards invasive screening procedures such as colonoscopy. There is a large unmet screening need calling for an accurate, non-invasive and cost-effective test to screen for early neoplastic and pre-neoplastic lesions. Our goal is to identify effective biomarker combinations to develop a screening test aimed at detecting precancerous lesions and early CRC stages, based on a multigene assay performed on peripheral blood mononuclear cells (PBMC).Methods: A pilot study was conducted on 92 subjects. Colonoscopy revealed 21 CRC, 30 adenomas larger than 1 cm and 41 healthy controls. A panel of 103 biomarkers was selected by two approaches: a candidate gene approach based on literature review and whole transcriptome analysis of a subset of this cohort by Illumina TAG profiling. Blood samples were taken from each patient and PBMC purified. Total RNA was extracted and the 103 biomarkers were tested by multiplex RT-qPCR on the cohort. Different univariate and multivariate statistical methods were applied on the PCR data and 60 biomarkers, with significant p-value (< 0.01) for most of the methods, were selected.Results: The 60 biomarkers are involved in several different biological functions, such as cell adhesion, cell motility, cell signaling, cell proliferation, development and cancer. Two distinct molecular signatures derived from the biomarker combinations were established based on penalized logistic regression to separate patients without lesion from those with CRC or adenoma. These signatures were validated using bootstrapping method, leading to a separation of patients without lesion from those with CRC (Se 67%, Sp 93%, AUC 0.87) and from those with adenoma larger than 1cm (Se 63%, Sp 83%, AUC 0.77). In addition, the organ and disease specificity of these signatures was confirmed by means of patients with other cancer types and inflammatory bowel diseases.Conclusions: The two defined biomarker combinations effectively detect the presence of CRC and adenomas larger than 1 cm with high sensitivity and specificity. A prospective, multicentric, pivotal study is underway in order to validate these results in a larger cohort.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To examine whether drawing is useful in the detection of problems of psychosocial adaptation in children and adolescents with type 1 diabetes (T1D) and in improving communication with health professionals. Methods: We performed an exploratory descriptive study in 199 children and adolescents with T1D aged 413 years. The participants were asked to render a drawing on a suggested topic. The variables analyzed were related to the drawing and to clinical and sociodemographic data. Results: Most participants showed evidence of having a well-balanced personality, but there were also signs of affective or psychosocial difficulties. Conclusion: Drawing is a useful technique by which to identify children"s and adolescents" feelings and possible problems in adapting to T1D, as well as to gain information directly from the children themselves. Future studies should delimit the possibilities of this technique in clinical practice in greater detail.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To examine whether drawing is useful in the detection of problems of psychosocial adaptation in children and adolescents with type 1 diabetes (T1D) and in improving communication with health professionals. Methods: We performed an exploratory descriptive study in 199 children and adolescents with T1D aged 413 years. The participants were asked to render a drawing on a suggested topic. The variables analyzed were related to the drawing and to clinical and sociodemographic data. Results: Most participants showed evidence of having a well-balanced personality, but there were also signs of affective or psychosocial difficulties. Conclusion: Drawing is a useful technique by which to identify children"s and adolescents" feelings and possible problems in adapting to T1D, as well as to gain information directly from the children themselves. Future studies should delimit the possibilities of this technique in clinical practice in greater detail.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.