Development of a Conductometric Test for Frost Resistance of Concrete, HR-272, 1988

Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.

Test result-based sampling: an efficient design for estimating the accuracy of patient safety indicators.

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Melanin-based coloration in juvenile kestrels (Falco tinnunculus) covaries with anti-predatory personality traits

Recent studies have shown that melanin-based coloration is associated with the ability to cope with stressful environments, potentially explaining why coloration covaries with anti-predator behaviours, boldness and docility. To investigate whether these relationships are consistent across species, we performed a study in the European kestrel (Falco tinnunculus). Similar to our results found previously in the barn owl (Tyto alba), nestling kestrels displaying a larger sub-terminal black tail band stayed on their back longer (tonic immobility test) and breathed at a lower rate than individuals with a smaller black band when handled. However, in contrast to barn owls, nestling kestrels with a larger black tail band were more aggressive and more agitated. Our results strengthen the hypothesis that melanin coloration is related to stress response and in turn to the reaction to predators, a very important personality trait (i.e. boldness).

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .