Event models for tumor classification with SAGE gene expression data

Serial Analysis of Gene Expression (SAGE) is a relatively new method for monitoring gene expression levels and is expected to contribute significantly to the progress in cancer treatment by enabling a precise and early diagnosis. A promising application of SAGE gene expression data is classification of tumors. In this paper, we build three event models (the multivariate Bernoulli model, the multinomial model and the normalized multinomial model) for SAGE data classification. Both binary classification and multicategory classification are investigated. Experiments on two SAGE datasets show that the multivariate Bernoulli model performs well with small feature sizes, but the multinomial performs better at large feature sizes, while the normalized multinomial performs well with medium feature sizes. The multinomial achieves the highest overall accuracy.

Structural and biological investigation of ferrocene-substituted 3-methylidene-1,3-dihydro-2H-indol-2-ones

The Knoevenagel condensation of 1,3-dihydro-2H-indol-2-one with ferrocene carboxaldehyde afforded an approximate 2:1 mixture of the geometrical isomers (E)- and (Z)-3-ferrocenylmethylidene-1,3-dihydro-2H-indol-2-one respectively in an overall 67% yield; the air and solution-stable isomers were readily separated by preparative thin layer chromatography and their structures were unequivocally elucidated in solution, by (1)H NMR spectroscopy, and in the solid phase, by X-ray crystallography; both isomers of displayed in vitro toxicity against B16 melanoma and Vero cell lines in the micromolar range and inhibited the kinase VEGFR-2 with IC(50) values of ca. 200 nM.

South East London Palliative and End of Life Care Education and Training Strategy: Meeting the Education and Training Needs of the Health & Social Care Workforce Involved in the Care of Patients and Carers at the End of Life.

EXECUTIVE SUMMARY Aims 1. The aims of this strategy are • to ensure that a full range of education and training related to the adult end of life care pathway is available across South East London to meet the needs of our health and social care workforce • to enable those responsible for end of life care education and training commissioning to procure comprehensively from a full range of education providers in a systematic and strategic manner. Background 2. The work that underpins this strategy was begun by the South East London Cancer Network via its Palliative and End of Life Care Coordinating Group and then developed by way of the Marie Curie Delivering Choice Programme’s Education and Training work stream.

Survival in 176 patients with inoperable non small cell lung cancer treated initially with chemotherapy in a district general hospital

In advanced non-small cell lung cancer (NSCLC) platinum based chemotherapy with second generation drugs improves median survival (MS) to 8 months and 29% and 10% at 1 and 2 years. Platinum with a third generation drug can improve survival further (BMJ 1995;311: 899) (Spiro et al. Thorax 2004;59:828 Big Lung Trial; N Engl J Med 2003;346:92 ECOG study). NICE now recommends chemotherapy with platinum and a third generation drug for inoperable NSCLC as the first treatment modality. Methods: We audited survival of 176/461 consecutive patients referred for at least 3 courses of platinum and either gemcitabine or vinorelbine from July 2001 to December 2005. Minimal follow up 17 months. Chemotherapy was given on site. Radical radiotherapy for stage IIIA, palliative radiotherapy and second line drugs were given as felt appropriate. Results: 64% were male. 30 (17%) were <55 years ; 66 (37.5%) age 55–65 years; 63 (35.8%) aged 66–75 and 16 (9.1%) >75 years. 5 (2.8%) were stage II; 46 (26%) stage IIIA; 68 (38%) stage IIIB and 55 (30.8%) stage IV. 68 (38%) had 0– 2 courses; 63 (36%) 3 courses and 44 (25%) had 4 or more.

Temperature measurement in children with cancer: an evaluation

There is little agreement as to the most appropriate thermometer, the anatomical site to carry out temperature measurement in children with cancer, or the type of thermometer preferred by the patients. The authors carried out this study to assess temperature measurement in children with cancer who were admitted for febrile episodes. The body temperatures of children with cancer who were admitted consecutively between January and October 2005 to the paediatric department because of febrile episodes were measured on admission and over the next 24–36 hours using an electronic thermometer sublingually as the standard reference site. These measurements were compared with those obtained with two ear-based thermometers, a forehead thermometer, and from the axilla (representing current practice). The parents were asked about the type of thermometer they used at home and the children were asked about the type of thermometer they preferred. There were 34 admissions during this period, of which 19 (56%) were confirmed as febrile. Altogether, 108 sets of temperature measurements were obtained, producing a total of 540 measurements from these admissions. Measurements with the two ear-based thermometers in febrile children achieved higher sensitivity than that with axillary and the forehead measurements. The ear-based thermometer was the most common type used at home while the forehead thermometer was the one preferred by the children. In conclusion, ear-based temperature measurements in febrile children were more accurate than axillary and forehead temperature measurements. The current practice of axillary temperature measurement needs to be re-considered.

Mixed-Function Oxygenases And Xenobiotic Detoxication-Toxication Systems In Bivalve Mollusks

Components of a xenobiotic detoxication/toxication system involving mixed function oxygenases are present inMytilus edulis. Our paper critically reviews the recent literature on this topic which reported the apparent absence of such a system in bivalve molluscs and attempts to reconcile this viewpoint with our own findings on NADPH neotetrazolium reductase, glucose-6-phosphate dehydrogenase, aldrin epoxidation and other reports of the presence of mixed function oxygenases. New experimental data are presented which indicate that some elements of the detoxication/toxication system inM. edulis can be induced by aromatic hydrocarbons derived from crude oil. This includes a brief review of the results of long-term experiments in which mussels were exposed to low concentrations of the water accommodated fraction of North Sea crude oil (7.7–68 µg 1−1) in which general stress responses such as reduced physiological scope for growth, cytotoxic damage to lysosomal integrity and cellular damage are considered as characteristics of the general stress syndrome induced by the toxic action of the xenobiotics. In addition, induction in the blood cells of microsomal NADPH neotetrazolium reductase (associated with mixed function oxygenases) and the NADPH generating enzyme glucose-6-phosphate dehydrogenase are considered to be specific biological responses to the presence of aromatic hydrocarbons. The consequences of this detoxication/toxication system forMytilus edulis are discussed in terms of the formation of toxic electrophilic intermediate metabolites which are highly reactive and can combine with DNA, RNA and proteins with subsequent damage to these cellular constituents. Implications for neoplasms associated with the blood cells are also discussed. Finally, in view of the increased use of mussel species in pollutant monitoring programmes, the induction phenomenon which is associated with microsomal enzymes in the blood cells is considered as a possible tool for the detection of the biological effects of environmental contamination by low concentrations of certain groups of organic xenobiotics.

Piornales, enebrales y pinares oromediterráneos (Pino-Cytision oromediterranei) en el Sistema Central

Se revisan fitosociológicamente los bosques y matorrales oromediterráneos del Sistema Central pertenecientes a la alianza Pino-Cytision oromediterranei. Un suborden, una asociación y seis subasociaciones se proponen como nuevos: Juniperenalia nanae, Echinosparto pulviniformis-Cytisetum oromediterranei, Cytiso-Echinospartetum barnadesii ericetsoum arboreae, Junipero-Cytisetum oromediterranei adenocarpetosum hispanici, arctostaphylletosum crassifoliae, ericetosum aragonensis, genistetosum cinerascentis y populetosum tremulae. Asimismo, se proponen diversas correcciones nomenclaturales y se tipifican los principales sintáxones de la clase. Por último, se presenta un esquema sintaxonómico de la misma en la Península Ibérica hasta el nivel de asociación, con la diagnosis biogeográfica, ecológica y florística de los sintáxones de rango superior.Finalmente, en el apéndice florístico se proponen tres nuevas combinaciones nomenclaturales: Echinospartum ibericum Rivas-Martínez, Sánchez-Mata & Sancho, E. ibericum subsp. pulviniformis (Rivas-Martínez) Rivas-Martínez y Thymus praecox Opiz subsp. penyalarensis (Pau) Rivas-Martínez, Fernández-González & Sánchez-Mata.

Nomenclature and syntaxonomic notes on some high-rank syntaxa of the European grassland vegetation

We present descriptions of a new order (Ranunculo cortusifolii-Geranietalia reuteri and of a new alliance (Stachyo lusitanicae-Cheirolophion sempervirentis) for the herbaceous fringe communities of Macaronesia and of the southwestern Iberian Peninsula, respectively. A new alliance, the Polygalo mediterraneae-Bromion erecti (mesophilous post-cultural grasslands), was introduced for the Peninsular Italy. We further validate and typify the Armerietalia rumelicae (perennial grasslands supported by nutrient-poor on siliceous bedrocks at altitudes characterized by the submediterranean climate of central-southern Balkan Peninsula), the Securigero-Dasypyrion villosae (lawn and fallow-land tall-grass annual vegetation of Italy), and the Cirsio vallis-demoni-Nardion (acidophilous grasslands on siliceous substrates of the Southern Italy). Nomenclatural issues (validity, legitimacy, synonymy, formal corrections) have been discussed and clarified for the following names: Brachypodio-Brometalia, Bromo pannonici-Festucion csikhegyensis, Corynephoro-Plantaginion radicatae, Heleochloion, Hieracio-Plantaginion radicatae, Nardetea strictae, Nardetalia strictae, Nardo-Callunetea, Nardo-Galion saxatilis, Oligo-Bromion, Paspalo-Heleochloetalia, Plantagini-Corynephorion and Scorzoneret alia villosae. 

Expression of vascular endothelial growth factor (VEGF) and its receptors is regulated in eyes with intra-ocular tumours

The immunolocalization and gene expression of vascular endothelial growth factor (VEGF) and its cognate tyrosine kinase receptors, Flt-1 and KDR, has been studied in ocular melanomas and retinoblastomas using in situ hybridization and immunohistochemistry. Tumour-related alterations in VEGF/VEGF-receptor expression have also been examined in separate and uninvolved iris, retina and choroid of the same eyes. Although VEGF immunoreactivity in the normal retina was virtually absent, low-level VEGF expression was evident in the ganglion cell-bodies, Müller cells and in a distinct population of amacrine cells. VEGF gene expression was absent in the iris and choroid of normal eyes. In tumour-bearing eyes, high levels of VEGF protein and gene expression were observed within the vascularized regions of the tumours, while the adjacent retina and choroid showed increased VEGF levels when compared with normals. Flt-1 and KDR gene expression and immunolocalization occurred in VEGF-expressing ganglion, Müller and amacrine cells in normal eyes. Within the intra-ocular tumours, VEGF-receptor gene expression and protein was evident in the endothelial cells and also in cells close to the vessels, while in the adjacent retina, Flt-1 and KDR levels were elevated over normal, especially in the blood vessels. Flt-1 and KDR were both observed at elevated levels in the choroid and iris blood vessels. This study suggests that VEGF, Flt-1 and KDR are expressed by neural, glial and vascular elements within normal human retina. Intra-ocular tumours demonstrate a high level of VEGF and VEGF-receptor expression; within uninvolved, spatially separate retina, choroid and iris in the same eyes, expression is also elevated, especially within the vasculature. Retinal vascular endothelia may respond to high intra-ocular levels of VEGF by increasing expression of their VEGF receptors, a phenomenon which could have relevance to neoplasm-related ocular neovascularization.

Characterization of a thymidylate synthase (TS)-inducible cell line: a model system for studying sensitivity to TS- and non-TS-targeted chemotherapies

Thymidylate synthase (TS) is responsible for the de novo synthesis of thymidylate, which is required for DNA synthesis and repair and which is an important target for fluoropyrimidines such as 5-fluorouracil (5-FU), and antifolates such as Tomudex (TDX), ZD9331, and multitargeted antifolate (MTA). To study the importance of TS expression in determining resistance to these agents, we have developed an MDA435 breast cancer-derived cell line with tetracycline-regulated expression of TS termed MTS-5. We have demonstrated that inducible expression of TS increased the IC(50) dose of the TS-targeted therapeutic agents 5-FU, TDX, and ZD9331 by 2-, 9- and 24-fold respectively. An IC(50) dose for MTA was unobtainable when TS was overexpressed in these cells, which indicated that MTA toxicity is highly sensitive to increased TS expression levels. The growth inhibitory effects of the chemotherapeutic agents CPT-11, cisplatin, oxaliplatin, and Taxol were unaffected by TS up-regulation. Cell cycle analyses revealed that IC(50) doses of 5-FU, TDX and MTA caused an S-phase arrest in cells that did not overexpress TS, and this arrest was overcome when TS was up-regulated. Furthermore, the S-phase arrest was accompanied by 2- to 4-fold increased expression of the cell cycle regulatory genes cyclin E, cyclin A, and cyclin dependent kinase 2 (cdk2). These results indicate that acute increases in TS expression levels play a key role in determining cellular sensitivity to TS-directed chemotherapeutic drugs by modulating the degree of S-phase arrest caused by these agents. Moreover, CPT-11, cisplatin, oxaliplatin, and Taxol remain highly cytotoxic in cells that overexpress TS.

The Role of Thymidylate Synthase Induction in Modulating p53-regulated Gene Expression in Response to 5-Fluorouracil and Antifolates

Thymidylate synthase (TS) is a critical target for chemotherapeutic agents such as 5-fluorouracil (5-FU) and antifolates such as tomudex (TDX),multitargeted antifolate, and ZD9331. Using the MCF-7 breast cancer line, we have developed p53 wild-type (M7TS90) and null (M7TS90-E6) isogenic lines with inducible TS expression (approximately 6-fold induction compared with control after 48 h). In the M7TS90 line, inducible TS expression resulted in a moderate approximately 3-fold increase in 5-FU IC-50(72 h) dose and a dramatic >20-fold increase in the IC-50(72 h) doses of TDX, multitargeted antifolate, and ZD9331. S-phase cell cycle arrest and apoptosis induced by the antifolates were abrogated by TS induction. In contrast, cell cycle arrest and apoptosis induced by 5-FU was unaffected by TS expression levels. Inactivation of p53 significantly increased resistance to 5-FU and the antifolates with IC-50(72 h) doses for 5-FU and TDX of >100 and >10 microM, respectively, in the M7TS90-E6 cell line. Furthermore, p53 inactivation completely abrogated the cell cycle arrest and apoptosis induced by 5-FU. The antifolates induced S-phase arrest in the p53 null cell line; however, the induction of apoptosis by these agents was significantly reduced compared with p53 wild-type cells. Both inducible TS expression and the addition of exogenous thymidine (10 microM) blocked p53 and p21 induction by the antifolates but not by 5-FU in the M7TS90 cell line. Similarly, inducible TS expression and exogenous thymidine abrogated antifolate but not 5-FU-mediated up-regulation of Fas/CD95 in M7TS90 cells. Our results indicate that in M7TS90 cells, inducible TS expression modulates p53 and p53 target gene expression in response to TS-targeted antifolate therapies but not to 5-FU.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Cytohesin Binder and Regulator (Cybr) is Not Essential for T- and Dendritic-Cell Activation and Differentiation

Cybr (also known as Cytip, CASP, and PSCDBP) is an interleukin-12-induced gene expressed exclusively in hematopoietic cells and tissues that associates with Arf guanine nucleotide exchange factors known as cytohesins. Cybr levels are dynamically regulated during T-cell development in the thymus and upon activation of peripheral T cells. In addition, Cybr is induced in activated dendritic cells and has been reported to regulate dendritic cell (DC)-T-cell adhesion. Here we report the generation and characterization of Cybr-deficient mice. Despite the selective expression in hematopoietic cells, there was no intrinsic defect in T- or B-cell development or function in Cybr-deficient mice. The adoptive transfer of Cybr-deficient DCs showed that they migrated efficiently and stimulated proliferation and cytokine production by T cells in vivo. However, competitive stem cell repopulation experiments showed a defect in the abilities of Cybr-deficient T cells to develop in the presence of wild-type precursors. These data suggest that Cybr is not absolutely required for hematopoietic cell development or function, but stem cells lacking Cybr are at a developmental disadvantage compared to wild-type cells. Collectively, these data demonstrate that despite its selective expression in hematopoietic cells, the role of Cybr is limited or largely redundant. Previous in vitro studies using overexpression or short interfering RNA inhibition of the levels of Cybr protein appear to have overestimated its immunological role.