Bentonite Treatment for Economical Dust Reduction on Limestone Surfaced Secondary Roads, HR-351, 1995

This research project was directed at laboratory and field evaluation of sodium montmorillonite clay (Bentonite) as a dust palliative for limestone surfaced secondary roads. It was postulated that the electrically charged surfaces (negative) of the clay particles could interact with the charged surfaces (positive) of the limestone and act as a bonding agent to agglomerate fine (-#200) particulates, and also to bond the fine particulates to larger (+#200) limestone particles. One mile test roads were constructed in Tama, Appanoose, and Hancock counties in Iowa using Bentonite treatment levels (by weight of aggregate) ranging from 3.0 to 12.0%. Construction was accomplished by adding dry Bentonite to the surfacing material and then dry road mixing. The soda ash/water solution (dispersing agent) was spray applied and the treated surfacing material wet mixed by motor graders to a consistency of 2 to 3 inch slump concrete. Two motor graders working in tandem provided rapid mixing. Following wet mixing the material was surface spread and compacted by local traffic. Quantitative and qualitative periodic evaluations and testing of the test roads was conducted with respect to dust generation, crust development, roughness, and braking characteristics. As the Bentonite treatment level increased dust generation decreased. From a cost/benefit standpoint, an optimum level of treatment is about 8% (by weight of aggregate). For roads with light traffic, one application at this treatment level resulted in a 60-70% average dust reduction in the first season, 40-50% in the second season, and 20-30% in the third season. Crust development was rated at two times better than untreated control sections. No discernible trend was evident with respect to roughness. There was no evident difference in any of the test sections with respect to braking distance and braking handling characteristics, under wet surface conditions compared to the control sections. Chloride treatments are more effective in dust reduction in the short term (3-4 months). Bentonite treatment is capable of dust reduction over the long term (2-3 seasons). Normal maintenance blading operations can be used on Bentonite treated areas. Soda ash dispersed Bentonite treatment is estimated to be more than twice as cost effective per percent dust reduction than conventional chloride treatments, with respect to time. However, the disadvantage is that there is not the initial dramatic reduction in dust generation as with the chloride treatment. Although dust is reduced significantly after treatment there is still dust being generated. Video evidence indicates that the dust cloud in the Bentonite treated sections does not rise as high, or spread as wide as the cloud in the untreated section. It also settles faster than the cloud in the untreated section. This is considered important for driving safety of following traffic, and for nuisance dust invasion of residences and residential areas. The Bentonite appears to be functioning as a bonding agent.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Introducción a la farmacia galénica: un reto en primer año de farmacia

[spa] Este curso académico 2009-2010 se implanta el nuevo plan de estudios de Farmacia en la Universidad de Barcelona, diseñado según los planteamientos del EEES. Como consecuencia, y por primera vez en la historia de la Facultad de Farmacia de la UB, se imparte una asignatura troncal de cariz galénico en el primer año de la carrera. Esto constituye un nuevo reto para el Grupo de Innovación Docente de Tecnología Farmacéutica (GIDTF), dado que la asignatura Introducción a la Farmacia Galénica se ha de impartir a grandes grupos de estudiantes, al inicio de su carrera, mediante sesiones teóricas de 1,5 h. Excepcionalmente en este curso académico, la asignatura se imparte en el primer semestre y se repite en el segundo. En este trabajo se presenta el planteamiento metodológico presencial diseñado para esta asignatura, apoyado en estrategias no presenciales como foro de debate, recursos on-line, cuestionarios y tareas de autoevaluación a través de la plataforma Moodle del Campus Virtual de la UB, puesto que el equipo docente considera prioritario iniciar al estudiante en el uso de la misma en el primer año de carrera. Se han efectuado encuestas de satisfacción a los estudiantes que se han evaluado, así también como los resultados académicos obtenidos. En el análisis de los puntos fuertes y débiles de la metodología empleada, se han detectado evaluaciones positivas y también aspectos que podrían mejorarse, estableciendo las medidas correctoras adecuadas. En cuanto a los resultados académicos, han sido muy satisfactorios. [eng] This academic year 2009-2010, the new curriculum of Pharmacy according to the premises of the EHEA is started at the University of Barcelona. As a result, for the first time in the history of the Faculty of Pharmacy of UB, an obligatory galenic subject will be given during the first year of the career. This is a new challenge for Teaching Innovation Group of Pharmaceutical Technology (GIDTF), as the subject Introduction to Galenic Pharmacy is given by a team of teachers to large groups of students who began its career, through theoretical sessions of 1.5 h. The subject will be taught exceptionally this academic year in the first semester and repeated in the second. In this paper we present the methodological approach designed to face this subject, supported by virtual strategies as discussion forum, online resources, self-assessment test and work through the platform Moodle of the Virtual Campus UB, as the team considers it a priority to initiate the student in using it in the first year of pharmacy study. Were carried out satisfaction surveys to students and we have evaluated them, as well as academic performance. Through the analysis of the methodology, we detected positive evaluations and areas for improvement that have been used to establish appropriate corrective measures. Academic results have been very satisfactory.

Description of a pure seed fraction of oat through usual evaluations and radiographic images

The objective of this work was to evaluate the width and length incidence in a single seed fraction of oat [Avena sativa (L.)] cv. Cristal. The seeds were selected by a mechanical divider and by hand, and their correspondence to radiographic images in seeds with glumes and their caryopses. The width and length of the seeds with glumes and their caryopses were measured with electronic calliper, and their weight, with precision balance. Radiographic images of seeds with glumes were taken with an X-ray experimental equipment. The analyst selected seeds with glumes by the width and by the length previously determined and so with more weight, than that obtained by hand selection was slightly narrower, larger and lighter. The presence of the glumes masked the caryopses real dimensions (width and length), and conduced the analyst to select seeds that differed more by the width than by the length. The radiographic images showed the presence, or not, of caryopses inside the seed and its real dimensions. The mechanical partition method for seeds showed to be more efficient because the analyst subjectivity was not considered when the selection upon its dimensions was done. The X-ray analysis was a useful tool that complements the pure seed fraction selection as another factor of seed quality.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Développement d'un Test Sérologique Contre le Virus de la Chorioméningite Lymphocytaire

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).

The QUASAR reproducibility study, Part II: Results from a multi-center Arterial Spin Labeling test-retest study.

Arterial Spin Labeling (ASL) is a method to measure perfusion using magnetically labeled blood water as an endogenous tracer. Being fully non-invasive, this technique is attractive for longitudinal studies of cerebral blood flow in healthy and diseased individuals, or as a surrogate marker of metabolism. So far, ASL has been restricted mostly to specialist centers due to a generally low SNR of the method and potential issues with user-dependent analysis needed to obtain quantitative measurement of cerebral blood flow (CBF). Here, we evaluated a particular implementation of ASL (called Quantitative STAR labeling of Arterial Regions or QUASAR), a method providing user independent quantification of CBF in a large test-retest study across sites from around the world, dubbed "The QUASAR reproducibility study". Altogether, 28 sites located in Asia, Europe and North America participated and a total of 284 healthy volunteers were scanned. Minimal operator dependence was assured by using an automatic planning tool and its accuracy and potential usefulness in multi-center trials was evaluated as well. Accurate repositioning between sessions was achieved with the automatic planning tool showing mean displacements of 1.87+/-0.95 mm and rotations of 1.56+/-0.66 degrees . Mean gray matter CBF was 47.4+/-7.5 [ml/100 g/min] with a between-subject standard variation SD(b)=5.5 [ml/100 g/min] and a within-subject standard deviation SD(w)=4.7 [ml/100 g/min]. The corresponding repeatability was 13.0 [ml/100 g/min] and was found to be within the range of previous studies.

Are niche-based species distribution models transferable in space?

Aim To assess the geographical transferability of niche-based species distribution models fitted with two modelling techniques. Location Two distinct geographical study areas in Switzerland and Austria, in the subalpine and alpine belts. Methods Generalized linear and generalized additive models (GLM and GAM) with a binomial probability distribution and a logit link were fitted for 54 plant species, based on topoclimatic predictor variables. These models were then evaluated quantitatively and used for spatially explicit predictions within (internal evaluation and prediction) and between (external evaluation and prediction) the two regions. Comparisons of evaluations and spatial predictions between regions and models were conducted in order to test if species and methods meet the criteria of full transferability. By full transferability, we mean that: (1) the internal evaluation of models fitted in region A and B must be similar; (2) a model fitted in region A must at least retain a comparable external evaluation when projected into region B, and vice-versa; and (3) internal and external spatial predictions have to match within both regions. Results The measures of model fit are, on average, 24% higher for GAMs than for GLMs in both regions. However, the differences between internal and external evaluations (AUC coefficient) are also higher for GAMs than for GLMs (a difference of 30% for models fitted in Switzerland and 54% for models fitted in Austria). Transferability, as measured with the AUC evaluation, fails for 68% of the species in Switzerland and 55% in Austria for GLMs (respectively for 67% and 53% of the species for GAMs). For both GAMs and GLMs, the agreement between internal and external predictions is rather weak on average (Kulczynski's coefficient in the range 0.3-0.4), but varies widely among individual species. The dominant pattern is an asymmetrical transferability between the two study regions (a mean decrease of 20% for the AUC coefficient when the models are transferred from Switzerland and 13% when they are transferred from Austria). Main conclusions The large inter-specific variability observed among the 54 study species underlines the need to consider more than a few species to test properly the transferability of species distribution models. The pronounced asymmetry in transferability between the two study regions may be due to peculiarities of these regions, such as differences in the ranges of environmental predictors or the varied impact of land-use history, or to species-specific reasons like differential phenotypic plasticity, existence of ecotypes or varied dependence on biotic interactions that are not properly incorporated into niche-based models. The lower variation between internal and external evaluation of GLMs compared to GAMs further suggests that overfitting may reduce transferability. Overall, a limited geographical transferability calls for caution when projecting niche-based models for assessing the fate of species in future environments.

Concrete Pavement Mixture Design and Analysis (MDA): Development and Evaluation of Vibrating Kelly Ball Test (VKelly Test) for the Workability of Concrete, 2015

Due to the low workability of slipform concrete mixtures, the science of rheology is not strictly applicable for such concrete. However, the concept of rheological behavior may still be considered useful. A novel workability test method (Vibrating Kelly Ball or VKelly test) that would quantitatively assess the responsiveness of a dry concrete mixture to vibration, as is desired of a mixture suitable for slipform paving, was developed and evaluated. The objectives of this test method are for it to be cost-effective, portable, and repeatable while reporting the suitability of a mixture for use in slipform paving. The work to evaluate and refine the test was conducted in three phases: 1. Assess whether the VKelly test can signal variations in laboratory mixtures with a range of materials and proportions 2. Run the VKelly test in the field at a number of construction sites 3. Validate the VKelly test results using the Box Test developed at Oklahoma State University for slipform paving concrete The data collected to date indicate that the VKelly test appears to be suitable for assessing a mixture’s response to vibration (workability) with a low multiple operator variability. A unique parameter, VKelly Index, is introduced and defined that seems to indicate that a mixture is suitable for slipform paving when it falls in the range of 0.8 to 1.2 in./√s.

Teaching Motivational Interviewing to Medical Students to Improve Behavior Change Counseling Skills - Results of a Pilot Test

BACKGROUND: Patient behavior accounts for half or more of the variance in health, disease, mortality and treatment outcome and costs. Counseling using motivational interviewing (MI) effectively improves the substance use and medical compliance behavior of patients. Medical training should include substantial focus on this key issue of health promotion. The objective of the study is to test the efficacy of teaching MI to medical students. METHODS: Thirteen fourth-year medical students volunteered to participate. Seven days before and after an 8-hour interactive MI training workshop, each student performed a video-recorded interview with two standardized patients: a 60 year-old alcohol dependent female consulting a primary care physician for the first time about fatigue and depression symptoms; and a 50 year-old male cigarette smoker hospitalized for myocardial infarction. All 52 videos (13 students×2 interviews before and after training) were independently coded by two blinded clinicians using the Motivational Interviewing Training Integrity (MITI, 3.0). MITI scores consist of global spirit (Evocation, Collaboration, Autonomy/Support), global Empathy and Direction, and behavior count summary scores (% Open questions, Reflection to question ratio, % Complex reflections, % MI-adherent behaviors). A "beginning proficiency" threshold (BPT) is defined for each of these 9 scores. The proportion of students reaching BPT before and after training was compared using McNemar exact tests. Inter-rater reliability was evaluated by comparing double coding, and test-retest analyses were conducted on a sub-sample of 10 consecutive interviews by each coder. Weighted Kappas were used for global rating scales and intra-class correlations (ICC) were computed for behavior count summary scores. RESULTS: The percent of counselors reaching BPT before and after MI training increased significantly for Evocation (15% to 65%, p<.001), Collaboration (27% to 77%, p=.001), Autonomy/Support (15% to 54%, p=.006), and % Open questions (4% to 38%, p=.004). Proportions increased, but were not statistically significant for Empathy (38% to 58%, p=.18), Reflection to question ratio (0% to 15%, p=.12), % Complex reflection (35% to 54%, p=.23), and % MI-adherent behaviors (8% to 15%, p=.69). There was virtually no change for the Direction scale (92% to 88%, p=1.00). The reliability analyses produced mixed results. Weighted kappas for inter-rater reliability ranged from .14 for Direction to .51 for Collaboration, and from .27 for Direction to .80 for Empathy for test-retest. ICCs ranged from .20 for Complex reflections to .89 for Open questions (inter-rater), and from .67 for Complex reflections to .99 for Reflection to question ratio (test-retest). CONCLUSION: This pilot study indicates that a single 8-hour training in motivational interviewing for voluntary fourth-year medical students results in significant improvement of some MI skills. A larger sample of randomly selected medical students observed over longer periods should be studied to test if MI training generalizes to medical students. Inter-rater reliability and test-retest findings indicate a need for caution when interpreting the present results, as well as for more intensive training to help appropriately capture more dimensions of the process in future studies.