974 resultados para Polymerase chain reaction (PCR)


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Apolipoprotein E (protein: apo E; gene: APOE) plays an important role in the multifactorial etiology of both Alzheimer's disease (AD) and lipid level concentrations. The polymerase chain reaction (PCR) was used to investigate the APOE gene polymorphism in 446 unrelated Caucasians, among them 23 AD patients, and 100 Afro-Brazilians living in Porto Alegre, Brazil. The frequencies of the APOE*2, APOE*3 and APOE*4 alleles were 0.075, 0.810 and 0.115 in Caucasians and 0.075, 0.700 and 0.225 in Afro-Brazilians, respectively (c2 = 8.72, P = 0.013). A highly significant association was observed between the APOE*4 allele and AD in this population-based sample. The APOE*4 frequency in AD patients (39%) was about four times higher than in the general Caucasian population (11.5%). The influence of each of the three common APOE alleles on lipid traits was evaluated by the use of the average excess statistic. The E*2 allele is associated with lower levels of triglycerides and of total and non-HDL cholesterol in both men and women. Conversely, the E*4 allele is associated with higher levels of these traits in women only. The effect of APOE alleles was of greater magnitude in women.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Thr(118)Met substitution in the peripheral myelin protein 22 (PMP22) gene has been detected in a number of families with demyelinating Charcot-Marie-Tooth (CMT1) neuropathy or with the hereditary neuropathy with liability to pressure palsy, but in none of them has it consistently segregated with the peripheral neuropathy. We describe here a CMT1 family (a 63-year-old man, his brother and his niece) in which two mutations on different chromosomes were found in the PMP22 gene, the 17p duplication, detected by fluorescent semiquantitative polymerase chain reaction (PCR) of microsatellite markers localized within the duplicated region on chromosome 17p11.2-p12, and the Thr(118)Met substitution, detected by direct sequencing the four coding exons of the PMP22 gene. A genotype/phenotype correlation study showed that the neuropathy segregates with the duplication and that the amino acid substitution does not seem to modify the clinical characteristics or the severity of the peripheral neuropathy. We did not find any evidence to characterize this substitution as a polymorphism in the population studied and we propose that the high frequency reported for this point mutation in the literature suggests that the Thr(118)Met substitution may be a hotspot for mutations in the PMP22 gene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Occult hepatitis B virus (HBV) infection has been reported as cases in which HBV DNA was detected despite the absence of any HBV serological markers or in cases in which anti-HBc antibody was the sole marker. The aim of the present study was to determine, using the polymerase chain reaction (PCR), whether HBV infection occurs in hepatitis C and non-A-E hepatitis patients without serological evidence of hepatitis B infection in São Paulo State. Two different populations were analyzed: 1) non-A-E hepatitis patients, including 12 patients with acute and 50 patients with chronic hepatic disorders without serological evidence of infection with known hepatitis viruses; 2) 43 patients previously diagnosed as hepatitis C with positive results for anti-HCV and HCV RNA. Among hepatitis C patients, anti-HBc was detected in 18.6% of the subjects. Three different sets of primers were employed for HBV DNA detection by nested PCR, covering different HBV genes: C, S and X. HBV-DNA was not detected in any sample, whereas the positive controls did produce signals. The lack of HBV DNA detection with these pairs of primers could be due to a very low viral load or to the presence of mutations in their annealing sites. The latter is unlikely as these primers were screened against an extensive dataset of HBV sequences. The development of more sensitive methods, such as real time PCR, to detect circular covalent closed DNA is necessary in order to evaluate this question since previous studies have shown that cryptic hepatitis B might occur.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In 2000, Enterococcus faecalis resistant to vancomycin was first reported at a tertiary hospital in Porto Alegre, southern Brazil. The resistance spread to other hospitals and surveillance programs were established by hospital infection committees to prevent the spread of vancomycin-resistant enterococci. In February 2002, an isolate initially identified at the genus level as Enterococcus was obtained by surveillance culture (rectal swab) from a patient admitted to a hospital for treatment of septic arthritis in the shoulder. The isolate proved to be resistant to vancomycin by the disc diffusion method and confirmed by an E-test resulting in a minimal inhibitory concentration of > or = 256 µg/ml. This isolate was sent to a reference laboratory (Laboratório Especial de Bacteriologia e Epidemiologia Molecular, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, USP) for further study and proved to be an E. gallinarum by the polymerase chain reaction (PCR) using specific primers for the species. Due to the phenotype of unusually high vancomycin resistance, the isolate presumably had the resistance genes (vanA and vanB) and this was confirmed by PCR, which indicated the presence of the vanA gene. A 10.8-kb Tn1546-related transposon was also identified by long-PCR. Interspecies transfer of the vancomycin-resistance gene from the donor E. gallinarum was performed in a successful conjugation experiment in vitro, using E. faecium GE-1 and E. faecalis JH22 as receptors. This is the first report of the detection of a vanA determinant naturally acquired by E. gallinarum in Brazil, indicating the importance of characterizing VRE by both phenotype and genotype methods.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

It is well known that the risk of development of gastric cancer (GC) in Helicobacter pylori-infected patients depends on several factors. Thus, the aim of this study was to investigate the effect of proinflammatory cytokine gene polymorphisms for IL-1β, IL-1RN and TNF-α on the development of GC in a Brazilian population. A total of 202 biopsies obtained from Brazilian patients with chronic gastritis and GC were included in the study. Infection with H. pylori cagA+ was determined by the polymerase chain reaction (PCR) as previously described. IL-1β, IL-1RN and TNF-α polymorphism genotyping was performed by restriction fragment length polymorphism PCR. Associations between gene polymorphisms, clinical diseases and virulence markers were evaluated using either the χ² test or the Fisher exact test. Our results demonstrated that the IL-1β -511 C/C and IL-1β -511 C/T alleles were associated with chronic gastritis in H. pylori-positive patients (P = 0.04 and P = 0.05, respectively) and the IL-1β -511 C/C genotype was associated with GC (P = 0.03). The frequency of IL-1RN alleles from patients with chronic gastritis and GC indicated that there was no difference between the genotypes of the groups studied. Similar results were found for TNF-α -308 gene polymorphisms. Our results indicate that the IL-1β -511 C/C and C/T gene polymorphisms are associated with chronic gastritis and GC development in H. pylori-infected individuals.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Our objective was to investigate the distributions of six single nucleotide polymorphisms (SNPs) MS4A2 E237G, MS4A2 C-109T, ADRB2 R16G, IL4RA I75V,IL4 C-590T, and IL13 C1923T in Mauritian Indian and Chinese Han children with asthma. This case-control association study enrolled 382 unrelated Mauritian Indian children, 193 with asthma and 189 healthy controls, and 384 unrelated Chinese Han children, 192 with asthma and 192 healthy controls. The SNP loci were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism for the Chinese Han samples and TaqMan real-time quantitative PCR for the Mauritian Indian samples. In the Mauritian Indian children, there was a significant difference in the distribution of IL13 C1923T between the asthma and control groups (P=0.033). The frequency of IL13 C1923T T/T in the Mauritian Indian asthma group was significantly higher than in the control group [odds ratio (OR)=2.119, 95% confidence interval=1.048-4.285]. The Chinese Han children with asthma had significantly higher frequencies ofMS4A2 C-109T T/T (OR=1.961, P=0.001) and ADRB2 R16G A/A (OR=2.575, P=0.000) than the control group. The IL13 C1923T locus predisposed to asthma in Mauritian Indian children, which represents an ethnic difference from the Chinese Han population. TheMS4A2 C-109T T/T and ADRB2 R16G A/Agenotypes were associated with asthma in the Chinese Han children.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Rotaviruses are the main cause of infantile acute diarrhea, and a monovalent (G1P[8]) vaccine against the virus was introduced into the Brazilian National Immunization Program for all infants in March 2006. The objectives of this study were to determine the rate and genotype distribution of rotavirus causing infantile diarrhea in the Triângulo Mineiro region of Brazil during 2011-2012 and to assess the impact of local vaccination. Fecal specimens were analyzed for detection and characterization of rotavirus using polyacrylamide gel electrophoresis, reverse transcription followed by polymerase chain reaction (PCR), and PCR-genotyping assays. Overall, rotavirus was diagnosed in 1.7% (6/348) of cases. Rotavirus positivity rates decreased 88% [95% confidence intervals (CI)=15.2, 98.3%; P=0.026] in 2011 and 78% (95%CI=30.6, 93.0%; P=0.007) in 2012 when compared with available data for baseline years (2005/2006) in Uberaba. In Uberlândia, reductions of 95.3% (95%CI=66.0, 99.4%; P=0.002) in 2011, and 94.2% (95%CI=56.4, 99.2%; P=0.004) in 2012 were also observed compared with data for 2008. The circulation of rotavirus G2P[4] strains decreased during the period under study, and strains related to the P[8] genotype reemerged in the region. This study showed a marked and sustained reduction of rotavirus-related cases, with a lack of rotavirus in the 2011 and 2012 seasons, suggesting a positive impact of the vaccination program.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This research aimed to verify the presence of virulence genes in strains of Escherichia coli isolated from grated cheese sold in farmers' markets of Cuiabá-MT, Brazil. Forty samples of this food were submitted for microbiological analysis and 22 (55%) tested positive for E. coli. Next, 64 strains of E. coli were isolated from the positive samples and screened by the polymerase chain reaction (PCR) for the presence of the genes encoding the following virulence factors: stx1 and stx2 (verotoxin types 1 and 2), eae (intimin), lt1 (heat-labile toxin type 1), st1 (heat-stable toxin type 1), cnf1 and cnf2 (cytotoxic necrozing factor types 1 and 2), and cdtB (cytolethal distending toxin). All the isolates were negative for the genes stx1, stx2, eae, lt1, st1, cnf1, and cdtB, and five strains (7.81%) were positive for cnf2. A low prevalence of E. coli positive for virulence factors associated with the pathogenesis of diarrhoea was observed in this study. However, the presence of CNF-2 producing strains and the possibility of occurrence and scattering of other virulence factors that were not surveyed in the work indicate the risk related to the consumption of grated cheese from farmers' markets.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed to evaluate the presence of enterotoxigenic S. aureus in the endogenous starter and in Artisan Minas cheeses from the Serra da Canastra. Sixteen samples of endogenous starters and cheese were collected during the rainy and dry seasons. The isolation and enumeration of S. aureus were performed using the PetrifilmTM-Rapid S. aureus Plate Count method. The presence of enterotoxin in the cheese samples was analyzed by the Optimal Sensitivity Plate (OSP) method and the ELFA-VIDAS®-Staph enterotoxin-II assay. S. aureus strains were tested for their ability to produce enterotoxins using the Optimal Sensitivity Plate (OSP) method and the polymerase chain reaction (PCR) assay for the classical enterotoxin genes. The Optimal Sensitivity Plate (OSP) method data showed that staphylococcal enterotoxin A (SEA) was detected in 75% of the cheese samples, but no toxin was detected with the ELFA-VIDAS method. It was found that 12.5% of the isolated strains produced staphylococcal enterotoxin A (SEA) and staphylococcal enterotoxin C (SEC). When using the the polymerase chain reaction (PCR) assay, only one isolate was found to harbor an enterotoxin gene, contrary our expectations. However, discrepancies between the immunological and molecular assays are not uncommon. Despite the fact that most isolates did not produce classical enterotoxins, high S. aureus counts in the cheese samples causes concern since there is a risk of the presence of non-classical enterotoxins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PCR-based technique for GMO detection is the most reliable choice because of its high sensitivity and specificity. As a candidate of the European Union, Turkey must comply with the rules for launching into the market, traceability, and labeling of GMOs as established by EU legislation. Therefore, the objective of this study is to assess soybean products in the Turkish market to verify compliance with legislation using qualitative Polymerase Chain Reaction (PCR) assay to detect the presence of GM soybean and to quantify its amount of GM soybean in the samples tested positive using real-time PCR. DNA extracted by the modified CTAB method was properly used for PCR amplification of food materials. The amplification of a 118 bp DNA fragment of the lectin gene from soybean by PCR was successfully achieved in all samples. The GMO screening was based on the detection of 35S promoter and NOS terminator sequences. The GM positive samples were subjected to detection of Roundup ReadyTM soybean (RR) using quantitative real-time PCR. It was found that 100% of the tested food samples contained less than 0.1 per cent of EPSPS gene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The allele-specific polymerase chain reaction (PCR) was used to screen for the presence of benomyl resistance, and to characterize their levels and frequencies in field populations of Venturia inaequalis during two seasons. Three hundred isolates of V. inaequalis were collected each season from infected leaves of MalusX domestica. Borkh c.v. Mcintosh. The trees used were sprayed in the year prior to collection with five applications of benomyl, its homologue Azindoyle, or water. Monoconidial isolates of V. inaequalis were grown on 2% potato dextrose agar (PDA) for four weeks. Each isolate was taken from a single lesion from a single leaf. Total genomic DNA was extracted from the four week old colonies of V. inaequalis, prepared and used as a template in PCR reactions. PCR reactions were achieved by utilizing allele-specific primers. Each primer was designed to amplify fragments from a specific allele. Primer Vin was specific for mutations conferring the ben^^"^ phenotype. It was expected to amplify a 171 bp. DNA fragment from the ben^"^ alleles only. Primers BenHR and BenMR were specific for mutations conferring the ben"" and ben'^'' phenotypes, respectively. They were expected to amplify 172 bp. and 165 bp. DNA fragments from the ben"" and ben"^" alleles, respectively. Of the 953 isolates tested, 414 (69.9%) were benomyl sensitive (ben^) and 179 (30.1%) were benomyl resistant. All the benomyl resistant alleles were ben^"", since neither the ben"" nor the ben"" alleles were detected. Frequencies of benomyl resistance were 23%, 24%, and 23% for the 1997 collections, and were 46%, 26% and 38% for the 1998 collections for benomyl, Azindoyle and water treatments, respectively. Growth assay was performed to evaluate the applicability of using PCR in monitoring benomyl resistance in fungal field populations. Tests were performed on 14 isolates representing the two phenotypes (ben^ and ben^"'' alleles) characterized by PCR. Results of those tests were in agreement with PCR results. Enzyme digestion was also used to evaluate the accuracy and reliability of PCR products. The mutation associated with the ben^"'' phenotype creates a unique site for the endonuclease enzyme Bsh^236^ allowing the use of enzyme digestion. Isolates characterized by PCR as ben^'^'^ alleles had this restriction site for the SsA7l2361 enzyme. The most time consuming aspect of this study was growing fungal isolates on culture media for DNA extraction. In addition, the risk of contamination or losing the fungus during growth processes was relatively high. A technique for extracting DNA directly from lesions on leaves has been used (Luck and Gillings 1 995). In order to apply this technique in experiments designed to monitor fungicide resistance, a lesion has to be homogeneous for fungicide sensitivity. For this purpose, PCR protocol was used to determine lesion homogeneity. One hundred monoconidial isolates of V. inaequalis from 10 lesions (10-conidia/ lesion) were tested for their phenotypes with respect to benomyl sensitivity. Conidia of six lesions were homogeneous, while conidia of the remaining lesions were mixtures of ben^ and ben^ phenotypes. Neither the ben" nor the ben' phenotype was detected.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recombinant human adenovirus (Ad) vectors are being extensively explored for their use in gene therapy and recombinant vaccines. Ad vectors are attractive for many reasons, including the fact that (1) they are relatively safe, based on their use as live oral vaccines, (2) they can accept large transgene inserts, (3) they can infect dividing and postmitotic cells, and (4) they can be produced to high titers. However, there are also a number of major problems associated with Ad vectors, including transient foreign gene expression due to host cellular immune responses, problems with humoral immunity, and the creation of replication competent adenoviruses (RCA). Most Ad vectors contain deletions in the E1 region that allow for insertion of a transgene. However, the E1 gene products are required for replication and thus must be supplied in trans by a helper ceillille that will allow for the growth and packaging of the defective virus. For this purpose the 293 cell line (Graham et al., 1977) is used most often; however, homologous recombination between the vector and the cell line often results in the generation of RCA. The presence of RCA in batches of adenoviral vectors for clinical use is a safety risk because tlley . may result in the mobilization and spread of the replication-defective vector viruses, and in significant tissue damage and pathogenicity. The present research focused on the alteration of the 293 cell line such that RCA formation can be eliminated. The strategy to modify the 293 cells involved the removal of the first 380 bp of the adenovirus genome through the process of homologous recombination. The first step towards this goal involved identifying and cloning the left-end cellular-viral jUl1ction from 293 cells to assemble sequences required for homologous recombination. Polymerase chain reaction (PCR) was performed to clone the junction, and the clone was verified through sequencing. The plasn1id PAM2 was then constructed, which served as the targeting cassette used to modify the 293 cells. The cassette consisted of (1) the cellular-viral junction as the left-end region of homology, (2) the neo gene to use for positive selection upon tranfection into 293 cells, (3) the adenoviral genome from bp 380 to bp 3438 as the right-end region of homology, and (4) the HSV-tk gene to use for negative selection. The plasmid PAM2 was linearized to produce a double strand break outside the region of homology, and transfected into 293 cells using the calcium-phosphate technique. Cells were first selected for their resistance to the drug G418, and subsequently for their resistance to the drug Gancyclovir (GANC). From 17 transfections, 100 pools of G418f and GANCf cells were picked using cloning lings and expanded for screening. Genomic DNA was isolated from the pools and screened for the presence of the 380 bps using PCR. Ten of the most promising pools were diluted to single cells and expanded in order to isolate homogeneous cell lines. From these, an additional 100 G41Sf and GANef foci were screened. These preliminary screening results appear promising for the detection of the desired cell line. Future work would include further cloning and purification of the promising cell lines that have potentially undergone homologous recombination, in order to isolate a homogeneous cell line of interest.