951 resultados para HUMAN-ENDOTHELIAL-CELLS


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A human melanoma-associated chondroitin sulfate proteoglycan (MCSP), recognized by mAb 9.2.27, plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. We report here the molecular cloning and nucleotide sequencing of cDNA encoding the entire core protein of human MCSP and provide its deduced amino acid sequence. This core protein contains an open reading frame of 2322 aa, encompassing a large extracellular domain, a hydrophobic transmembrane region, and a relatively short cytoplasmic tail. Northern blot analysis indicated that MCSP cDNA probes detect a single 8.0-kb RNA species expressed in human melanoma cell lines. In situ hybridization experiments with a segment of the MCSP coding sequence localized MCSP mRNA in biopsies prepared from melanoma skin metastases. Multiple human Northern blots with an MCSP-specific probe revealed a strong hybridization signal only with melanoma cells and not with other human cancer cells or a variety of human fetal and adult tissues. These data indicate that MCSP represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. The availability of cDNAs encoding MCSP should facilitate studies designed to establish correlations between structure and function of this molecule and help to establish its role in the progression of human malignant melanoma.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The development of new capillary networks from the normal microvasculature of the host appears to be required for growth of solid tumors. Tumor cells influence this process by producing both inhibitors and positive effectors of angiogenesis. Among the latter, the vascular endothelial growth factor (VEGF) has assumed prime candidacy as a major positive physiological effector. Here, we have directly tested this hypothesis in the brain tumor, glioblastoma multiforme, one of the most highly vascularized human cancers. We introduced an antisense VEGF expression construct into glioblastoma cells and found that (i) VEGF mRNA and protein levels were markedly reduced, (ii) the modified cells did not secrete sufficient factors so as to be chemoattractive for primary human microvascular endothelial cells, (iii) the modified cells were not able to sustain tumor growth in immunodeficient animals, and (iv) the density of in vivo blood vessel formation was reduced in direct relation to the reduction of VEGF secretion and tumor formation. Moreover, revertant cells that recovered the ability to secrete VEGF regained each of these tumorigenic properties. These results suggest that VEGF plays a major angiogenic role in glioblastoma.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

High molecular weight kininogen (HK) and factor XII are known to bind to human umbilical vein endothelial cells (HUVEC) in a zinc-dependent and saturable manner indicating that HUVEC express specific binding site(s) for those proteins. However, identification and immunochemical characterization of the putative receptor site(s) has not been previously accomplished. In this report, we have identified a cell surface glycoprotein that is a likely candidate for the HK binding site on HUVECs. When solubilized HUVEC membranes were subjected to an HK-affinity column in the presence or absence of 50 microM ZnCl2 and the bound membrane proteins eluted, a single major protein peak was obtained only in the presence of zinc. SDS/PAGE analysis and silver staining of the protein peak revealed this protein to be 33 kDa and partial sequence analysis matched the NH2 terminus of gC1q-R, a membrane glycoprotein that binds to the globular "heads" of C1q. Two other minor proteins of approximately 70 kDa and 45 kDa were also obtained. Upon analysis by Western blotting, the 33-kDa band was found to react with several monoclonal antibodies (mAbs) recognizing different epitopes on gC1q-R. Ligand and dot blot analyses revealed zinc-dependent binding of biotinylated HK as well as biotinylated factor XII to the isolated 33-kDa HUVEC molecule as well as recombinant gC1q-R. In addition, binding of 125I-HK to HUVEC cells was inhibited by selected monoclonal anti-gC1q-R antibodies. C1q, however, did not inhibit 125I-HK binding to HUVEC nor did those monoclonals known to inhibit C1q binding to gC1q-R. Taken together, the data suggest that HK (and factor XII) bind to HUVECs via a 33-kDa cell surface glycoprotein that appears to be identical to gC1q-R but interact with a site on gC1q-R distinct from that which binds C1q.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The mechanism of contrast enhancement of tumors using magnetic resonance imaging was investigated in MCF7 human breast cancer implanted in nude mice. Dynamic contrast-enhanced images recorded at high spatial resolution were analyzed by an image analysis method based on a physiological model, which included the blood circulation, the tumor, the remaining tissues, and clearance via the kidneys. This analysis enabled us to map in rapidly enhancing regions within the tumor, the capillary permeability factor (capillary permeability times surface area per voxel volume) and the fraction of leakage space. Correlation of these maps with T2-weighted spin echo images, with histopathology, and with immunohistochemical staining of endothelial cells demonstrated the presence of dense permeable microcapillaries in the tumor periphery and in intratumoral regions that surrounded necrotic loci. The high leakage from the intratumoral permeable capillaries indicated an induction of a specific angiogenic process associated with stress conditions that cause necrosis. This induction was augmented in tumors responding to tamoxifen treatment. Determination of the distribution and extent of this stress-induced angiogenic activity by contrast-enhanced MRI might be of diagnostic and of prognostic value.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two structurally unrelated chemicals, aflatoxin B1 and propane sultone, transformed human foreskin cells to a stage of anchorage-independent growth. Isolation from agar and repopulation in monolayer culture of these transformed cells was followed by transfection with a cDNA library, which resulted in cells that exhibited an altered epithelioid morphology. Chemically transformed/nontransfected cells and transfected normal cells did not undergo a significant morphological change. These epithelioid-appearing, transfected cells, when inoculated into nude mice, form progressively growing tumors. The tumors are histopathologically interpreted as carcinomas. All of the first generation tumors in the surrogate hosts exhibited characteristic rates of growth similar to those of transplants of spontaneous human tumors. In the second generation of tumor xenografts, the progressively growing tumors derived from the transfected cells exhibited a more rapid rate of growth. Southern analysis and reverse transcription PCR confirmed that a 1.3-kb genetic element was integrated into the genome and was actively being transcribed. Examination of the metaphase chromosomes in normal human cells revealed that the genetic element responsible for this conversion was located at site 31-32 of the q arm of chromosome 7. The DNA sequence of this 1.3-kb genetic element contains a coding region for 79 amino acids and a long 3'-untranslated region and appears to be identical to CATR1.3 isolated from tumors produced by methyl methanesulfonate-converted, nontransplantable human tumor cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The tyrosine kinases Flt4, Flt1, and Flk1 (or KDR) constitute a family of endothelial cell-specific receptors with seven immunoglobulin-like domains and a split kinase domain. Flt1 and Flk1 have been shown to play key roles in vascular development; these two receptors bind and are activated by vascular endothelial growth factor (VEGF). No ligand has been identified for Flt4, whose expression becomes restricted during development to the lymphatic endothelium. We have identified cDNA clones from a human glioma cell line that encode a secreted protein with 32% amino acid identity to VEGF. This protein, designated VEGF-related protein (VRP), specifically binds to the extracellular domain of Flt4, stimulates the tyrosine phosphorylation of Flt4 expressed in mammalian cells, and promotes the mitogenesis of human lung endothelial cells. VRP fails to bind appreciably to the extracellular domain of Flt1 or Flk1. The protein contains a C-terminal, cysteine-rich region of about 180 amino acids that is not found in VEGF. A 2.4-kb VRP mRNA is found in several human tissues including adult heart, placenta, ovary, and small intestine and in fetal lung and kidney.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Signal transduction initiated by crosslinking of antigen-specific receptors on T- and B-lymphoma cells induces apoptosis. In T-lymphoma cells, such crosslinking results in upregulation of the APO-1 ligand, which then interacts with induced or constitutively expressed APO-1, thereby triggering apoptosis. Here we show that crosslinking the membrane immunoglobulin on human lymphoma cells (Daudi) (that constitutively express APO-1) does not induce synthesis of APO-1 ligand. Further, a noncytotoxic fragment of anti-APO-1 antibody that blocks T-cell-receptor-mediated apoptosis in T-lymphoma cells does not block anti-mu-induced apoptosis. Hence, in B-lymphoma cells, apoptosis induced by signaling via membrane IgM is not mediated by the APO-1 ligand.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

ICSBP is a member of the interferon (IFN) regulatory factor (IRF) family that regulates expression of type I interferon (IFN) and IFN-regulated genes. To study the role of the IRF family in viral infection, a cDNA for the DNA-binding domain (DBD) of ICSBP was stably transfected into U937 human monocytic cells. Clones that expressed DBD exhibited a dominant negative phenotype and did not elicit antiviral activity against vesicular stomatitis virus (VSV) infection upon IFN treatment. Most notably, cells expressing DBD were refractory to infection by vaccinia virus (VV) and human immunodeficiency virus type 1 (HIV-1). The inhibition of VV infection was attributed to defective virion assembly, and that of HIV-1 to low CD4 expression and inhibition of viral transcription in DBD clones. HIV-1 and VV were found to have sequences in their regulatory regions similar to the IFN-stimulated response element (ISRE) to which IRF family proteins bind. Accordingly, these viral sequences and a cellular ISRE bound a shared factor(s) expressed in U937 cells. These observations suggest a novel host-virus relationship in which the productive infection of some viruses is regulated by the IRF-dependent transcription pathway through the ISRE.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Because repeated injury of the endothelium and subsequent turnover of intimal and medial cells have been implicated in atherosclerosis, we examined telomere length, a marker of somatic cell turnover, in cells from these tissues. Telomere lengths were assessed by Southern analysis of terminal restriction fragments (TRFs) generated by HinfI/Rsa I digestion of human genomic DNA. Mean TRF length decreased as a function of population doublings in human endothelial cell cultures from umbilical veins, iliac arteries, and iliac veins. When endothelial cells were examined for mean TRF length as a function of donor age, there was a significantly greater rate of decrease for cells from iliac arteries than from iliac veins (102 bp/yr vs. 47 bp/yr, respectively, P < 0.05), consistent with higher hemodynamic stress and increased cell turnover in arteries. Moreover, the rate of telomere loss as a function of donor age was greater in the intimal DNA of iliac arteries compared to that of the internal thoracic arteries (147 bp/yr vs. 87 bp/yr, respectively, P < 0.05), a region of the arterial tree subject to less hemodynamic stress. This indicates that the effect is not tissue specific. DNA from the medial tissue of the iliac and internal thoracic arteries showed no significant difference in the rates of decrease, suggesting that chronic stress leading to cellular senescence is more pronounced in the intima than in the media. These observations extend the use of telomere size as a marker for the replicative history of cells and are consistent with a role for focal replicative senescence in cardiovascular diseases.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To examine the role of complement components as regulators of the expression of endothelial adhesive molecules in response to immune complexes (ICs), we determined whether ICs stimulate both endothelial adhesiveness for leukocytes and expression of E-selectin and intercellular and vascular cell adhesion molecules 1 (ICAM-1 and VCAM-1). We found that ICs [bovine serum albumin (BSA)-anti-BSA] stimulated endothelial cell adhesiveness for added leukocytes in the presence of complement-sufficient normal human serum (NHS) but not in the presence of heat-inactivated serum (HIS) or in tissue culture medium alone. Depletion of complement component C3 or C8 from serum did not prevent enhanced endothelial adhesiveness stimulated by ICs. In contrast, depletion of complement component C1q markedly inhibited IC-stimulated endothelial adhesiveness for leukocytes. When the heat-labile complement component C1q was added to HIS, the capacity of ICs to stimulate endothelial adhesiveness for leukocytes was completely restored. Further evidence for the possible role of C1q in mediating the effect of ICs on endothelial cells was the discovery of the presence of the 100- to 126-kDa C1q-binding protein on the surface of endothelial cells (by cytofluorography) and of message for the 33-kDa C1q receptor in resting endothelial cells (by reverse transcription-PCR). Inhibition of protein synthesis by cycloheximide blocked endothelial adhesiveness for leukocytes stimulated by either interleukin 1 or ICs in the presence of NHS. After stimulation with ICs in the presence of NHS, endothelial cells expressed increased numbers of adhesion molecules (E-selectin, ICAM-1, and VCAM-1). Endothelial expression of adhesion molecules mediated, at least in part, endothelial adhesiveness for leukocytes, since leukocyte adhesion was blocked by monoclonal antibodies directed against E-selectin. These studies show that ICs stimulate endothelial cells to express adhesive proteins for leukocytes in the presence of a heat-labile serum factor. That factor appears to be C1q.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Platelet factor 4 (PF-4) is an archetype of the "chemokine" family of low molecular weight proteins that play an important role in injury responses and inflammation. From activated human leukocyte culture supernatants, we have isolated a form of PF-4 that acts as a potent inhibitor of endothelial cell proliferation. The PF-4 derivative is generated by peptide bond cleavage between Thr-16 and Ser-17, a site located downstream from the highly conserved and structurally important CXC motif. The unique cleavage leads to a loss of one of the structurally important large loops in the PF-4 molecule and generation of an N terminus with basic residues that have the potential to interact with the acidic extracellular domain of the G-protein-coupled chemokine receptor. The N-terminal processed PF-4 exhibited a 30- to 50-fold greater growth inhibitory activity on endothelial cells than PF-4. Since endothelial cell growth inhibition is the only known cellular activity of the cleaved PF-4, we have designated this chemokine endothelial cell growth inhibitor. The N-terminal processing of PF-4 may represent an important mechanism for modulating PF-4 activity on endothelial cells during tissue injury, inflammation, and neoplasia.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human melanoma cells can process the MAGE-1 gene product and present the processed nonapeptide EADPTGHSY on their major histocompatibility complex class I molecules, HLA-A1, as a determinant for cytolytic T lymphocytes (CTLs). Considering that autologous antigen presenting cells (APCs) pulsed with the synthetic nonapeptide might, therefore, be immunogenic, melanoma patients whose tumor cells express the MAGE-1 gene and who are HLA-A1+ were immunized with a vaccine made of cultured autologous APCs pulsed with the synthetic nonapeptide. Analyses of the nature of the in vivo host immune response to the vaccine revealed that the peptide-pulsed APCs are capable of inducing autologous melanoma-reactive and the nonapeptide-specific CTLs in situ at the immunization site and at distant metastatic disease sites.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human diploid fibroblast cells cease growth in culture after a finite number of population doublings. To address the cause of growth cessation in senescent IMR-90 human fibroblast cells, we determined the level of oxidative DNA damage by using 8-oxoguanine excised from DNA and 8-oxo-2'-deoxyguanosine in DNA as markers. Senescent cells excise from DNA four times more 8-oxoguanine per day than do early-passage young cells. The steady-state level of 8-oxo-2'-deoxyguanosine in DNA is approximately 35% higher in senescent cells than in young cells. Measurement of protein carbonyls shows that senescent cells did not appear to have elevated protein oxidation. To reduce the level of oxidative damage, we cultured cells under a more physiological O2 concentration (3%) and compared the replicative life span to the cells cultured at the O2 concentration of air (20%). We found that cells grown under 3% O2 achieved 50% more population doublings during their lifetime. Such an extension of life span resulted from the delayed onset of senescence and elevation of growth rate and saturation density of cells at all passages. The spin-trapping agent alpha-phenyl-t-butyl nitrone (PBN), which can act as an antioxidant, also effectively delayed senescence and rejuvenated near senescent cells. The effect is dose-dependent and is most pronounced for cells at the stage just before entry into senescence. Our data support the hypothesis that oxidative DNA damage contributes to replicative cessation in human diploid fibroblast cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The circulating blood exerts a force on the vascular endothelium, termed fluid shear stress (FSS), which directly impacts numerous vascular endothelial cell (VEC) functions. For example, high rates of linear and undisturbed (i.e. laminar) blood flow maintains a protective and quiescent VEC phenotype. Meanwhile, deviations in blood flow, which can occur at vascular branchpoints and large curvatures, create areas of low, and/or oscillatory FSS, and promote a pro-inflammatory, pro-thrombotic and hyperpermeable phenotype. Indeed, it is known that these areas are prone to the development of atherosclerotic lesions. Herein, we show that cyclic nucleotide phosphodiesterase (PDE) 4D (PDE4D) activity is increased by FSS in human arterial endothelial cells (HAECs) and that this activation regulates the activity of cAMP-effector protein, Exchange Protein-activated by cAMP-1 (EPAC1), in these cells. Importantly, we also show that these events directly and critically impact HAEC responses to FSS, especially when FSS levels are low. Both morphological events induced by FSS, as measured by changes in cell alignment and elongation in the direction of FSS, and the expression of critical FSS-regulated genes, including Krüppel-like factor 2 (KLF2), endothelial nitric oxide synthase (eNOS) and thrombomodlin (TM), are mediated by EPAC1/PDE4D signaling. At a mechanistic level, we show that EPAC1/PDE4D acts through the vascular endothelial-cadherin (VECAD)/ platelet-cell adhesion molecule-1 (PECAM1)/vascular endothelial growth factor receptor 2 (VEGFR2) mechanosensor to activate downstream signaling though Akt. Given the critical role of PDE4D in mediating these effects, we also investigated the impact of various patterns of FSS on the expression of individual PDE genes in HAECs. Notably, PDE2A was significantly upregulated in response to high, laminar FSS, while PDE3A was upregulated under low, oscillatory FSS conditions only. These data may provide novel therapeutic targets to limit FSS-dependent endothelial cell dysfunction (ECD) and atherosclerotic development.