“Islands” in Holocene forests: implications for forest openness, landscape clearance and “culture-steppe” species

Human activity has undoubtedly had a major impact on Holocene forested ecosystems, with the concurrent expansion of plants and animals associated with cleared landscapes and pasture, also known as 'culture-steppe'. However, this anthropogenic perspective may have underestimated the contribution of autogenic disturbance (e.g. wind-throw, fire), or a mixture of autogenic and anthropogenic processes, within early Holocene forests. Entomologists have long argued that the north European primary forest was probably similar in structure to pasture woodland. This idea has received support from the conservation biologist Frans Vera, who has recently strongly argued that the role of large herbivores in maintaining open forests in the primeval landscapes of Europe has been seriously underestimated. This paper reviews this debate from a fossil invertebrate perspective and looks at several early Holocene insect assemblages. Although wood taxa are indeed important during this period, species typical of open areas and grassland and dung beetles, usually associated with the dung of grazing animals, are persistent presences in many early woodland faunas. We also suggest that fire and other natural disturbance agents appear to have played an important ecological role in some of these forests, maintaining open areas and creating open vegetation islands within these systems. More work, however, is required to ascertain the role of grazing animals, but we conclude that fossil insects have a significant contribution to make to this debate. This evidence has fundamental implications in terms of how the palaeoecological record is interpreted, particularly by environmental archaeologists and palaeoecologists who may be more interested in identifying human-environment interactions rather than the ecological processes which may be preserved within palaeoecological records.

BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Multi-Party Negotiation When Agents Have Subjective Estimates of Bargaining Powers

This paper presents a method for generating Pareto-optimal solutions in multi-party negotiations. In this iterative method, decision makers (DMs) formulate proposals that yield a minimum payoff to their opponents. Each proposal belongs to the efficient frontier, DMs try to adjust to a common one. In this setting, each DM is supposed to have a given bargaining power. More precisely each DM is supposed to have a subjective estimate of the power of the different parties. We study the convergence of the method, and provide examples where there is no possible agreement resulting from it.