Expressed cadherin pseudogenes are localized to the critical region of the spinal muscular atrophy gene.

Low-copy repeats have been associated with genomic rearrangements and have been implicated in the generation of mutations in several diseases. Here we characterize a subset of low-copy repeats in the spinal muscular atrophy (SMA) region in human chromosome 5q13. We show that this repeated sequence, named c41-cad, is a highly expressed pseudogene derived from an intact neuronal cadherin gene, Br-cadherin, situated on 5p13-14. Br-cadherin is expressed specifically in the brain, whereas the c41-cad transcripts are 10-15 times more abundant and are present in all tissues examined. We speculate that the c41-cad repeats, separately or in concert with other repeats in the SMA region, are involved in the pathogenesis of SMA by promoting rearrangements and deletions.

In vivo assembly of rhodopsin from expressed polypeptide fragments.

Rhodopsin folding and assembly were investigated by expression of five bovine opsin gene fragments separated at points corresponding to proteolytic cleavage sites in the second or third cytoplasmic regions. The CH(1-146) and CH(147-348) gene fragments encode amino acids 1-146 and 147-348 of opsin, while the TH(1-240) and TH(241-348) gene fragments encode amino acids 1-240 and 241-348, respectively. Another gene fragment, CT(147-240), encodes amino acids 147-240. All five opsin polypeptide fragments were stably produced upon expression of the corresponding gene fragments in COS-1 cells. The singly expressed polypeptide fragments failed to form a chromophore with 11-cis-retinal, whereas coexpression of two or three complementary fragments [CH(1-146) + CH(147-348), TH(1-240) + TH(241-348), or CH(1-146) + CT(147-240) + TH(241-348)] formed pigments with spectral properties similar to wild-type rhodopsin. The NH2-terminal polypeptide in these rhodopsins showed a glycosylation pattern characteristic of wild-type COS-1 cell rhodopsin and was noncovalently associated with its complementary fragment(s). Further, the CH(1-146) + CH(147-348) rhodopsin showed substantial light-dependent activation of transducin. We conclude that the functional assembly of rhodopsin is mediated by the association of at least three protein-folding domains.

A receptor guanylyl cyclase expressed specifically in olfactory sensory neurons.

We have cloned an additional member (GC-D) of the membrane receptor guanylyl cyclase [GTP pyrophosphate-lyase (cyclizing), EC 4.6.1.2] family that is specifically expressed in a subpopulation of olfactory sensory neurons. The extracellular, putative ligand-binding domain of the olfactory cyclase is similar in primary structure to two guanylyl cyclases expressed in the retina but diverges considerably from other known guanylyl cyclases. The expression of GC-D RNA is restricted to a small, randomly dispersed population of neurons that is within a single topographic zone in the olfactory neuroepithelium and resembles the pattern of the more diverse seven-transmembrane-domain odorant receptors. These observations suggest that GC-D may function directly in odor recognition or in modulating the sensitivity of a subpopulation of sensory neurons to specific odors.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Avaliação da influência de emoções na tomada de decisão de sistemas computacionais.

Este trabalho avalia a influência das emoções humanas expressas pela mímica da face na tomada de decisão de sistemas computacionais, com o objetivo de melhorar a experiência do usuário. Para isso, foram desenvolvidos três módulos: o primeiro trata-se de um sistema de computação assistiva - uma prancha de comunicação alternativa e ampliada em versão digital. O segundo módulo, aqui denominado Módulo Afetivo, trata-se de um sistema de computação afetiva que, por meio de Visão Computacional, capta a mímica da face do usuário e classifica seu estado emocional. Este segundo módulo foi implementado em duas etapas, as duas inspiradas no Sistema de Codificação de Ações Faciais (FACS), que identifica expressões faciais com base no sistema cognitivo humano. Na primeira etapa, o Módulo Afetivo realiza a inferência dos estados emocionais básicos: felicidade, surpresa, raiva, medo, tristeza, aversão e, ainda, o estado neutro. Segundo a maioria dos pesquisadores da área, as emoções básicas são inatas e universais, o que torna o módulo afetivo generalizável a qualquer população. Os testes realizados com o modelo proposto apresentaram resultados 10,9% acima dos resultados que usam metodologias semelhantes. Também foram realizadas análises de emoções espontâneas, e os resultados computacionais aproximam-se da taxa de acerto dos seres humanos. Na segunda etapa do desenvolvimento do Módulo Afetivo, o objetivo foi identificar expressões faciais que refletem a insatisfação ou a dificuldade de uma pessoa durante o uso de sistemas computacionais. Assim, o primeiro modelo do Módulo Afetivo foi ajustado para este fim. Por fim, foi desenvolvido um Módulo de Tomada de Decisão que recebe informações do Módulo Afetivo e faz intervenções no Sistema Computacional. Parâmetros como tamanho do ícone, arraste convertido em clique e velocidade de varredura são alterados em tempo real pelo Módulo de Tomada de Decisão no sistema computacional assistivo, de acordo com as informações geradas pelo Módulo Afetivo. Como o Módulo Afetivo não possui uma etapa de treinamento para inferência do estado emocional, foi proposto um algoritmo de face neutra para resolver o problema da inicialização com faces contendo emoções. Também foi proposto, neste trabalho, a divisão dos sinais faciais rápidos entre sinais de linha base (tique e outros ruídos na movimentação da face que não se tratam de sinais emocionais) e sinais emocionais. Os resultados dos Estudos de Caso realizados com os alunos da APAE de Presidente Prudente demonstraram que é possível melhorar a experiência do usuário, configurando um sistema computacional com informações emocionais expressas pela mímica da face.

Using Emotion to Foster Acceptance: A Treatment Approach for Family Therapists Working with Transgender Adolescents and their Families

Currently, there is limited research and clinical focus on family therapy with transgender adolescents. When an adolescent discloses his/her transgender identity to his/her family, the family can experience an array of emotions, such as fear, distrust, anger, and sadness, along with confusion and invalidating behavior that can threaten secure attachment among family members. The purpose of this paper is to present a family therapy treatment approach for therapists working with transgender adolescents that is both culturally sensitive to the needs of these families as well as based on a systemic family therapy model. Emotionally Focused Family Therapy (EFFT) is a systemic model that is grounded in attachment theory and focuses on using emotion as a key tool in restructuring problematic relational patterns and fostering more secure family bonds. Through the use of a hypothetical case study, this paper aims at illustrating how EFFT can help family members process feelings related to the transgender identity of an adolescent family member and restore their attachment in a manner that strengthens family relationships and bonds.

Exploring How AFFECT (A Family Focused Emotion Communication Training) and Self Psychology Are Mutually Enhancing

This paper implicitly advocates for a rapprochement between psychodynamic and behavioral approaches to psychotherapy, by exploring the similarities and differences between self psychology and A Family Focused Emotion Communication Training (AFFECT), a behavioral parent training model. Self psychology, a theory with broad applicability, has been applied to several modalities besides behavioral ones. Generally speaking, self psychology and AFFECT are both relational approaches to psychotherapy that emphasize the impact of parent responsiveness, more specifically empathic attunement, on a child's emotional development and emotion regulation. Differentiating aspects of each model are identified to enhance the other model. AFFECT has relevance for pushing self psychology theory more in the direction of operations, which has implications for enhancing the research potential of self psychology, as well as for the training of the self-psychologist. Conversely, self psychology has relevance for coaching the parent with low self-esteem and decreased self-efficacy in AFFECT, which has potential implications for AFFECT treatment outcomes.

Examining the relationship among genes, attention bias to emotion, and depression in youth

The investigation of biologically initiated pathways to psychological disorder is critical to advance our understanding of mental illness. Research has suggested that attention bias to emotion may be an intermediate trait for depression associated with biologically plausible candidate genes, such as the serotonin transporter (5-HTTLPR) and catechol-o-methyl-transferase (COMT) genes, yet there have been mixed findings in regards to the precise direction of effects. The experience of recent stressful life events (SLEs) may be an important, yet currently unstudied, moderator of the relationship between genes and attention bias as SLEs have been associated with both gene expression and attention to emotion. Additionally, although attention biases to emotion have been studied as a possible intermediate trait associated with depression, no study has examined whether attention biases within the context of measured genetic risk lead to increased risk for clinical depressive episodes over time. Therefore, this research investigated both whether SLEs moderate the link between genetic risk (5-HTTLPR and COMT) and attention bias to emotion and whether 5-HTTLPR and COMT moderated the relationship between attention biases to emotional faces and clinical depression onset prospectively across 18 months within a large community sample of youth (n= 467). Analyses revealed a differential effect of gene. Youth who were homozygous for the low expressing allele of 5-HTTLPR (S/S) and had experienced more recent SLEs within the last three months demonstrated preferential attention toward negative emotional faces (angry and sad). However, youth who were homozygous for the high expressing COMT genotype (Val/Val) and had experienced more recent SLEs showed attentional avoidance of positive facial expressions (happy). Additionally, youth who avoided negative emotion (i.e., anger) and were homozygous for the S allele of the 5-HTTLPR gene were at greater risk for prospective depressive episode onset. Increased risk for depression onset was specific to the 5-HTTLPR gene and was not found when examining moderation by COMT. These findings highlight the importance of examining risk for depression across multiple levels of analysis, such as combined genetic, environmental, and cognitive risk, and is the first study to demonstrate clear evidence of attention biases to emotion functioning as an intermediate trait predicting depression.

EMOCause: an easy-adaptable approach to emotion cause contexts

In this paper we present a method to automatically identify linguistic contexts which contain possible causes of emotions or emotional states from Italian newspaper articles (La Repubblica Corpus). Our methodology is based on the interplay between relevant linguistic patterns and an incremental repository of common sense knowledge on emotional states and emotion eliciting situations. Our approach has been evaluated with respect to manually annotated data. The results obtained so far are satisfying and support the validity of the methodology proposed.

EmotiBlog: a fine-grained model for emotion detection in non-traditional textual genres

This paper presents the first version of EmotiBlog, an annotation scheme for emotions in non-traditional textual genres such as blogs or forums. We collected a corpus composed by blog posts in three languages: English, Spanish and Italian and about three topics of interest. Subsequently, we annotated our collection and carried out the inter-annotator agreement and a ten-fold cross-validation evaluation, obtaining promising results. The main aim of this research is to provide a finer-grained annotation scheme and annotated data that are essential to perform evaluation focused on checking the quality of the created resources.

Detecting implicit expressions of affect in text using EmotiNet and its extensions

In the past years, an important volume of research in Natural Language Processing has concentrated on the development of automatic systems to deal with affect in text. The different approaches considered dealt mostly with explicit expressions of emotion, at word level. Nevertheless, expressions of emotion are often implicit, inferrable from situations that have an affective meaning. Dealing with this phenomenon requires automatic systems to have “knowledge” on the situation, and the concepts it describes and their interaction, to be able to “judge” it, in the same manner as a person would. This necessity motivated us to develop the EmotiNet knowledge base — a resource for the detection of emotion from text based on commonsense knowledge on concepts, their interaction and their affective consequence. In this article, we briefly present the process undergone to build EmotiNet and subsequently propose methods to extend the knowledge it contains. We further on analyse the performance of implicit affect detection using this resource. We compare the results obtained with EmotiNet to the use of alternative methods for affect detection. Following the evaluations, we conclude that the structure and content of EmotiNet are appropriate to address the automatic treatment of implicitly expressed affect, that the knowledge it contains can be easily extended and that overall, methods employing EmotiNet obtain better results than traditional emotion detection approaches.

Interpersonal Emotion Dynamics in Mother-Daughter Dyads during Adolescence

Thesis (Ph.D, Psychology) -- Queen's University, 2016-05-16 14:38:20.622