Solutions of a two-dimensional dam-break problem

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Stability of solutions of linear difference equations with periodic coefficients

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.

Biomimetic triblock copolymer membranes: from aqueous solutions to solid supports

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.

A simple fluid cell for the study of aqueous solutions using THz time-domain spectroscopy

We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.

Are conventions solutions to uncertainty? Contrasting visions of social coordination

In recent years, there has been an increase in research on conventions motivated by the game-theoretic contributions of the philosopher David Lewis. Prior to this surge in interest, discussions of convention in economics had been tied to the analysis of John Maynard Keynes's writings. These literatures are distinct and have very little overlap. Yet this confluence of interests raises interesting methodological questions. Does the use of a common term, convention, denote a set of shared concerns? Can we identify what differentiates the game theoretic models from the Keynesian ones? This paper maps out the three most developed accounts of convention within economics and discusses their relations with each other in an attempt to provide an answer.

Societal choice for climate change futures: trees, biotechnology and clean development

The rate and magnitude of predicted climate change require that we urgently mitigate emissions or sequester carbon on a substantial scale in order to avoid runaway climate change. Geo- and bioengineering solutions are increasingly proposed as viable and practical strategies for tackling global warming. Biotechnology companies are already developing transgenic “super carbon-absorbing” trees, which are sold as a cost-effective and relatively low-risk means of sequestering carbon. The question posed in this article is, Do super carbon trees provide real benefits or are they merely a fanciful illusion? It remains unclear whether growing these trees makes sense in terms of the carbon cost of production and the actual storage of carbon. In particular, it is widely acknowledged that “carbon-eating” trees fail to sequester as much carbon as they oxidize and return to the atmosphere; moreover, there are concerns about the biodiversity impacts of large-scale monoculture plantations. The potential social and ecological risks and opportunities presented by such controversial solutions warrant a societal dialogue.

Molecular dynamics simulation insight into the mechanism of phenol adsorption at low coverages from aqueous solutions on microporous carbons

MD simulation studies showing the influence of porosity and carbon surface oxidation on phenol adsorption from aqueous solutions on carbons are reported. Based on a realistic model of activated carbon, three carbon structures with gradually changed microporosity were created. Next, a different number of surface oxygen groups was introduced. The pores with diameters around 0.6 nm are optimal for phenol adsorption and after the introduction of surface oxygen functionalities, adsorption of phenol decreases (in accordance with experimental data) for all studied models. This decrease is caused by a pore blocking effect due to the saturation of surface oxygen groups by highly hydrogen-bounded water molecules.

Adsorption from aqueous solutions on opened carbon nanotubes: organic compounds speed up delivery of water from inside

We report the results of first systematic studies of organic adsorption from aqueous solutions onto relatively long single walled carbon nanotubes (four tubes, in initial and oxidised forms). Using molecular dynamics simulations (GROMACS package) we discuss the behaviour of tube-water as well as tube-adsorbate systems, for three different adsorbates (benzene, phenol and paracetamol).