Parâmetros ruminais e desaparecimento da FDN da forragem em bovinos suplementados em pastagem na estação das águas

O objetivo do presente trabalho foi determinar o efeito de suplementos concentrados com diferentes degradabilidades da proteína (alta-75%, média-55% e baixa-35%) e o efeito da quantidade dos mesmos (0,5, 1,0 e 1,5 kg de MS/dia) sobre os parâmetros ruminais (pH e N-NH3) e o desaparecimento da FDN da forragem em bovinos pastejando Brachiaria brizantha cv. Marandu no período das águas. Foram utilizados dez bovinos canulados no rúmen com peso médio de 463 kg num esquema fatorial 3 x 3 com três repetições (blocos). A técnica do saco de náilon e a simulação do pastejo foram usadas para alcançar a cinética de degradação da FDN da forragem. Foram determinadas as concentrações N-NH3 e o pH ruminais durante dois dias, em vários horários. Não houve efeito dos suplementos, tampouco da quantidade destes sobre o desaparecimento da FDN da forragem, mas houve para os diferentes tempos de incubação, alcançando o potencial máximo de degradação (67,58%) às 96 horas de incubação. O pH ruminal variou de 5,7 a 7,4 com média de 6,48, não havendo efeito de tratamento e nem interação tratamento x tempo. Já para os horários de determinação houve diferenças significativas. Para o N-NH3 ruminal houve diferença significativa entre os tratamentos, sendo as maiores concentrações observadas para aqueles que apresentavam maior degradabilidade da proteína. Os primeiros horários após a suplementação apresentavam um maior pico de N-NH3 e os picos do período da manhã foram maiores que os da tarde. As diferentes concentrações de N-NH3 ruminal não alteraram a degradação da fibra.

Obtenção e caracterização de um compósito de poliuretano de mamona e pó de vidro para aplicações em insolantes térmicos

Thermal insulation is used to protect the heated or cooled surfaces by the low thermal conductivity materials. The rigid ricin polyurethane foams (PURM) are used for thermal insulation and depend on the type and concentration of blowing agent. Obtaining PURM occurs by the use of polyol, silicone, catalyst and blowing agent are pre -mixed, reacting with the isocyanate. The glass is reusable, returnable and recyclable heat insulating material, whose time of heat dissipation determines the degree of relaxation of its structure; and viscosity determines the conditions for fusion, operating temperatures, annealing, etc. The production of PURM composites with waste glass powder (PV) represents economical and renewable actions of manufacturing of thermal insulating materials. Based on these aspects, the study aimed to produce and characterize the PURM composites with PV, whose the mass percentages were 5, 10, 20, 30, 40 and 50 wt%. PURM was obtained commercially, while the PV was recycled from the tailings of the stoning process of a glassmaking; when the refining process was applied to obtain micrometer particles. The PURM + PV composites were studied taking into account the standard sample of pure PURM and the influence of the percentage of PV in this PURM matrix. The results of the chemical, physical and morphological characterization were discussed taking into account the difference in the microstructural morphology of the PURM+PV composites and the pure PURM, as well the results of the physicochemical, mechanical e thermophysical tests by values obtained of density, hardness, compressive strength, specific heat, thermal conductivity and diffusivity. In general, the structure of pure PURM showed large, elongated and regular pores, while PURM+PV composites showed irregular, small and rounded pores with shapeless cells. This may have contributed to reducing their mechanical strength, especially for PURM - PV50. The hardness and density were found to have a proportional relationship with the PV content on PURM matrix. The specific heat, thermal diffusivity and thermal conductivity showed proportional relationship to each other. So, this has been realized that the increasing the PV content on PURM matrix resulted in the rise of diffusivity and thermal conductivity and the decrease of the specific heat. However, the values obtained by the PURM composites were similar the values of pure PURM, mainly the PURM-PV5 and PURM-PV10. Therefore, these composites can be applied like thermal insulator; furthermore, their use could reduce the production costs and to preserve the environment

Estudo das interações polifenol-proteína e das reações de escurecimento não-enzimático para o processamento de cajuína

The cashew, a fruit from Brazilian Northeast is used to produce juice due to its flavor and vitamin C richness. However, its acceptance is limited due to its astringency. Cajuína is a derivate product appreciated by its characteristic flavor, freshness and lack of astringency, due to tannin removal. Cajuína is a light yellow beverage made from clarified cashew juice and sterilized after bottling. It differs from the integral and concentrated juice by the clarification and thermal treatment steps. Many problems such as haze and excessive browning could appear if these steps are not controlled. The objective of this work was divided into two stages with the aim to supply process information in order to obtain a good quality product with uniform characteristics (sensory and nutritional). Polyphenol-protein interaction was studied at the clarification step, which is an empirical process, to provide values on the amount of clarifying solution (gelatin) that must be added to achieve a complete juice clarification. Clarification essays were performed with juice dilutions of 1:2 and 1:10 and the effect of metabissulfite and tannic acid addition was evaluated. It was not possible to establish a clarification point. Metabissulfite did not influenced the clarification process however tannic acid addition displaced the clarification point, showing the difficulty visual monitoring of the process. Thermal treatment of clarified juice was studied at 88, 100, 111 e 121 °C. To evaluate the non-enzymatic browning, vitamin C, 5-hidroximetilfurfural (5-HMF) and sugar variation were correlated with color parameters (reflectance spectra, color difference and CIELAB). Kinetic models were obtained for reflectance spectra, ascorbic acid and 5-HMF. It was observed that 5-HMF introduction followed a first order kinetic rate at the beginning of the thermal treatment and a zero order kinetic at later process stages. An inverse correlation was observed between absorbance at 420 nm and ascorbic acid degradation, which indicates that ascorbic acid might be the principal factor on cajuína non-enzymatic browning. Constant sugar concentration showed that this parameter did not contribute directly to the nonenzymatic browning. Optimization techniques showed showed that to obtain a high vitamin C and a low 5-HMF content, the process must be done at 120 ºC. With the water-bath thermal treatment, the 90 °C temperature promoted a lower ascorbic acid degradation at the expense of a higher 5-HMF level

Estudo do Cultivo de dois clones de Escherichia coli recombinantes (eIF, LACK) para a Expressão de Antígenos da Leishmania chagasi

With advent of the technology of the recombinant DNA, the recombinant protein expression becomes an important tool in the studies of the structure, function and identification of new proteins, mainly with therapeutical purposes. The Escherichia coli has been procarioto predominant in the studies of genetic engineering due to wealth of information regarding its metabolism. Despite the expressivo advance of the studies of molecular biology and the immunology of the infections, it does not exist, currently, no prophylactic drug capable to prevent calazar. Of this form, it exists a great necessity of specific antigen identification for the vaccine development and kits for disgnostic against the visceral Leishmaniose. In this context, this work objectified to study the recombinant antigen expression of the Leishmania chagasi during the culture of Escherichia coli in shaker. A first set of assays was carried through with the objective of if knowing the kinetic behavior of the growth of two clones recombinant proteins (eIF, LACK) in two different compositions of culture medium (2xTY, TB) supplemented by antibiotics, without IPTG addition. In the second stage of the assays, the procedure of induction for IPTG was carried through, in order to verify the influence of the composition of the ways tested in the expression them recombinant proteins. On the basis of the gotten results, can be observed that the high complexity of culture medium favored the kinetic one of growth of clones recombinant (eIF, LACK), however, to if to deal with the assays submitted to the procedure of induction for IPTG, the raised complexity of culture medium did not favor the expression of recombinant proteins. On the other hand, they had been gotten resulted positive for all clones recombinant (eIF, LACK) tested, confirmed through the eletroforético profile

Remoção de óleo da água de produção por flotação em coluna utilizando tensoativos de origem vegetal

In the petroleum industry, water is always present in the reservoir formation together with petroleum and natural gas and this fact provokes the production of water with petroleum, resulting in a great environmental impact. Several methods can be applied for treatment of oily waters, such as: gravitational vases, granulated media filtration systems, flotation process, centrifugation process and the use of hydrocyclones, which can also be used in a combined way. However, the flotation process has showed a great efficiency as compared with other methods, because these methods do not remove great part of the emulsified oil. In this work was investigated the use of surfactants derived from vegetable oils, OSS and OGS, as collectors, using the flotation process in a glass column with a porous plate filter in its base for the input of the gaseous steam. For this purpose, oil/water emulsions were prepared using mechanical stirring, with concentrations around 300 ppm. The air flow rate was set at 700 cm3/min and the porous plate filter used for the generation of the air bubbles has pore size varying from 16 to 40 Pm. The column operated at constant volume (1500mL). A new methodology has been developed to collect the samples, where, instead of collecting the water phase, it was collected the oil phase removed by the process in the top of the flotation column. It has been observed that it is necessary to find an optimum surfactant concentration to achieve enhanced removal efficiency. Being for OSS 1.275 mmol/L and for OGS 0.840 mmol/L, with removal efficiencies of 93% and 99%, respectively, using synthetic solutions. For the produced water, the removal in these concentrations was 75% for OSS and 65% for OGS. It is possible to remove oil from water in a flotation process using surfactants of high HLB, fact that is against the own definition of HLB (Hydrophile-Lipophile Balance). The interfacial tension is an important factor in the oil removal process using a flotation process, because it has direct interference in the coalescence of the oil drops. The spreading of the oil of the air bubble should be considered in the process, and for the optimum surfactant concentrations it reached a maximum value. The removal kinetics for the flotation process using surfactants in the optimum concentration has been adjusted according to a first order model, for synthetic water as for the produced water.

Avaliação da secagem do bagaço de cajá usando planejamento fatorial composto central

This work deals with the kinetics assay of Cajá (Spondias mombin L.) bagasse drying by an experimental design using a tray dryer. In order to add-value to this product a kinetic study has been carried out. A central composite experimental design has been carried out to evaluate the influence of the operational variables: input air temperature (55; 65 e 75ºC); the drying air velocity (3.2; 4.6 e 6.0 m/s) and the fixed bed thickness (0.8; 1.2 e 1.6 cm) and as response variable the the moisture content (dry basis). The results showed that the diffusional Fick model fitted quite well the experimental data. The best condition found has been input air temperature of 75ºC, drying air velocity of 6.0 m/s as well as fixed bed thickness of 0.8 cm. The experimental design assay showed that the main effects as well as the second ones were significant at 95% confindance level. The best operational condition according to statistical planning was 75 oC input air temperature, 6.0 m.s-1 drying air velocity and 0.8 cm fixed bed thickness. In this case, the equilibrium moisture content (1.3% dry basis) occured at 220 minutes

Produção de biodiesel a partir de óleo de coco (Cocos nucifera L

The production of biodiesel has become an important and attractive process for the production of alternative fuels. This work presents a study of the biodiesel production from coconut oil (Cocos nucifera L.), by two routes: direct transesterification using NaOH as catalyst and esterification (with H2SO4) followed by basic transesterification. The reactor was built in pirex with 1L of capacity and was equipped with a jacket coupled with a thermostatic bath to temperature control, a mecanical stirring is also present in the reactor. The analysis of oil composition was carried out by gas chromatography and esters compounds were identified. The parameters of molar ratio oil/alcohol, reaction time and temperature were studied and their influence on the conversion products was evaluated using experimental planning (23). The molar ratio was the most significant variable by the statistical planning analysis. Conversions up to 85.3% where achived in the esterification/transesterification, with molar ratio 1:6 at 60ºC and 90 minutes of reaction. For the direct transesterification, route conversions up 87.4% eas obtained using 1:6.5 molar ratio at 80ºC and 60 minutes of reaction. The Coconut oil was characterized by their physic chemical properties and key constituents of the oil. The lauric acid was the main constituint and the oil showed high acidity. The biodiesel produced was characterized by its main physicochemical properties, indicating satisfactory results when compared to standard values of National Petroleum Agency. The work was supplemented with a preliminary assessment of the reaction kinetic

Digital monitoring of mycelium growth kinetics and vigor of shiitake (Lentinula edodes (Berk.) Pegler) on agar medium

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Absorção de manganês em soja RR sob efeito do glifosate

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Extração do óleo essencial de Cymbopogom winterianus J. com CO2 pressurizado

The extraction with pressurized fluids has become an attractive process for the extraction of essential oils, mainly due the specific characteristics of the fluids near the critical region. This work presents results of the extraction process of the essential oil of Cymbopogon winterianus J. with CO2 under high pressures. The effect of the following variables was evaluated: solvent flow rate (from 0.37 to 1.5 g CO2/min), pressure (66.7 and 75 bar) and temperature (8, 10, 15, 20 and 25 ºC) on the extraction kinetics and the total yield of the process, as well as in the solubility and composition of the C. winterianus essential oil. The experimental apparatus consisted of an extractor of fixed bed and the dynamic method was adopted for the calculation of the oil solubility. Extractions were also accomplished by conventional techniques (steam and organic solvent extraction). The determination and identification of extract composition were done by gas chromatography coupled with a mass spectrometer (GC-MS). The extract composition varied in function of the studied operational conditions and also related to the used extraction method. The main components obtained in the CO2 extraction were elemol, geraniol, citronellol and citronellal. For the steam extraction were the citronellal, citronellol and geraniol and for the organic solvent extraction were the azulene and the hexadecane. The most yield values (2.76%) and oil solubility (2.49x10-2 g oil/ g CO2) were obtained through the CO2 extraction in the operational conditions of T = 10°C, P = 66.7 bar and solvent flow rate 0.85 g CO2/min

Aproveitamento de subprodutos da industrialização do escargot

The waste in the industries of escargot processing is very big. This is composed basically of escargot meat out of the commercialization patterns and the visceras. In this context, there is a need to take advantage to the use of these sub-products. A possibility should be drying them and transforming them in a certain form to be reused. Than, the present work has the objective of studying the reutilization of the sub-products of the escargot industrialization for by means of drying process. The samples were transformed in pastes, through a domestic processor for approximately 1 minute and compacted in trays of aluminum without perforations with three different heights (5 mm, 10 mm and 15 mm). The drying was accomplished in a tray dryer with air circulation and transverse flow at a speed of 0,2 m/s and three temperature levels (70°C, 80°C and 90ºC). A drying kinetics study was accomplished for the obtained curves and for the heat and mass transfer coefficients using experimental procedures based in an experimental planning of 22 factorial type. Microbiological and physiochemical analysis were also accomplished for the in nature and the dehydrated sub-products. In the drying process, it was observed the great importance of the external resistances to the mass transfer and heat in the period of constant tax influenced by the temperature. The evaporation taxes indicated a mixed control of the mass transfer for the case of the thickest layers. As already expected, the drying constant behavior was influenced by the temperature and thickness of the medium, increasing and decreasing. The statistical analysis of the results, in agreement with the factorial planning 22, showed that the fissures, the shrinking of the transfer area and the formation of a crust on the surface might have contributed to the differences between the practical results and the linear model proposed. The temperature and the thickness influenced significantly in the answers of the studied variables: evaporation tax and drying constant. They were obtained significant statistical models and predictive ones for evaporation tax for the meat as well as for the visceras

Avaliação da remoção de sulfeto de hidrogênio do gás natural em uma coluna de absorção

Natural gas, although basically composed by light hydrocarbons, also presents in its composition gaseous contaminants such as CO2 (carbon dioxide) and H2S (hydrogen sulfide). Hydrogen sulfide, which commonly occurs in oil and gas exploration and production activities, besides being among the gases that are responsible by the acid rain and greenhouse effect, can also cause serious harm to health, leading even to death, and damages to oil and natural gas pipelines. Therefore, the removal of hydrogen sulfide will significantly reduce operational costs and will result in oil with best quality to be sent to refinery, thereby resulting in economical, environmental, and social benefits. These factors highlight the need for the development and improvement of hydrogen sulfide sequestrating agents to be used in the oil industry. Nowadays there are several procedures for hydrogen sulfide removal from natural gas used by the petroleum industry. However, they produce derivatives of amines that are harmful to the distillation towers, form insoluble precipitates that cause pipe clogging and produce wastes of high environmental impact. Therefore, the obtaining of a stable system, in inorganic or organic reaction media, that is able to remove hydrogen sulfide without forming by-products that affect the quality and costs of natural gas processing, transport and distribution is of great importance. In this context, the evaluation of the kinetics of H2S removal is a valuable procedure for the treatment of natural gas and disposal of the byproducts generated by the process. This evaluation was made in an absorption column packed with Raschig ring, where natural gas with H2S passes through a stagnant solution, being the contaminant absorbed by it. The content of H2S in natural gas in column output was monitored by an H2S analyzer. The comparison between the obtained curves and the study of the involved reactions have not only allowed to determine the efficiency and mass transfer controlling step of the involved processes but also make possible to effect a more detailed kinetic study and evaluate the commercial potential of each reagent

Análise dos Processos de Flotação e Oxidação Avançada para o Tratamento de Efluente Modelo da Indústria do Petróleo

The generation of wastes in most industrial process is inevitable. In the petroleum industry, one of the greatest problems for the environment is the huge amount of produced water generated in the oil fields. This wastewater is a complex mixture and present great amounts. These effluents can be hazardous to the environmental without adequate treatment. This research is focused in the analysis of the efficiencies of the flotation and photo-oxidation processes to remove and decompose the organic compounds present in the produced water. A series of surfactants derivated from the laurilic alcohol was utilized in the flotation to promote the separation. The experiments have been performed with a synthetic wastewater, carefully prepared with xylene. The experimental data obtained using flotation presented a first order kinetic, identified by the quality of the linear data fitting. The best conditions were found at 0.029 g.L-1 for the surfactant EO 7, 0.05 g.L-1 for EO 8, 0.07 g.L-1 for EO 9, 0.045 g.L-1 for EO 10 and 0.08 g.L-1 for EO 23 with the following estimated kinetic constants: 0.1765, 0.1325, 0.1210, 0.1531 and 0.1699 min-1, respectively. For the series studied, the most suitable surfactant was the EO 7 due to the lower reagent onsumption, higher separation rate constant and higher removal efficiency of xylene in the aqueous phase (98%). Similarly to the flotation, the photo-Fenton process shows to be efficient for degradation of xylene and promoting the mineralization of the organic charge around 90% and 100% in 90 min

Implementação de um modelo computacional para estudo do processo Fischer-Tropsch em reator de leito de lama

This work aims at the implementation and adaptation of a computational model for the study of the Fischer-Tropsch reaction in a slurry bed reactor from synthesis gas (CO+H2) for the selective production of hydrocarbons (CnHm), with emphasis on evaluation of the influence of operating conditions on the distribution of products formed during the reaction.The present model takes into account effects of rigorous phase equilibrium in a reactive flash drum, a detailed kinetic model able of predicting the formation of each chemical species of the reaction system, as well as control loops of the process variables for pressure and level of slurry phase. As a result, a system of Differential Algebraic Equations was solved using the computational code DASSL (Petzold, 1982). The consistent initialization for the problem was based on phase equilibrium formed by the existing components in the reactor. In addition, the index of the system was reduced to 1 by the introduction of control laws that govern the output of the reactor products. The results were compared qualitatively with experimental data collected in the Fischer-Tropsch Synthesis plant installed at Laboratório de Processamento de Gás - CTGÁS-ER-Natal/RN