Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Prediction of cross-recognition of peptide-HLA A2 by Melan-A-specific cytotoxic T lymphocytes using three-dimensional quantitative structure-activity relationships.

The cross-recognition of peptides by cytotoxic T lymphocytes is a key element in immunology and in particular in peptide based immunotherapy. Here we develop three-dimensional (3D) quantitative structure-activity relationships (QSARs) to predict cross-recognition by Melan-A-specific cytotoxic T lymphocytes of peptides bound to HLA A*0201 (hereafter referred to as HLA A2). First, we predict the structure of a set of self- and pathogen-derived peptides bound to HLA A2 using a previously developed ab initio structure prediction approach [Fagerberg et al., J. Mol. Biol., 521-46 (2006)]. Second, shape and electrostatic energy calculations are performed on a 3D grid to produce similarity matrices which are combined with a genetic neural network method [So et al., J. Med. Chem., 4347-59 (1997)] to generate 3D-QSAR models. The models are extensively validated using several different approaches. During the model generation, the leave-one-out cross-validated correlation coefficient (q (2)) is used as the fitness criterion and all obtained models are evaluated based on their q (2) values. Moreover, the best model obtained for a partitioned data set is evaluated by its correlation coefficient (r = 0.92 for the external test set). The physical relevance of all models is tested using a functional dependence analysis and the robustness of the models obtained for the entire data set is confirmed using y-randomization. Finally, the validated models are tested for their utility in the setting of rational peptide design: their ability to discriminate between peptides that only contain side chain substitutions in a single secondary anchor position is evaluated. In addition, the predicted cross-recognition of the mono-substituted peptides is confirmed experimentally in chromium-release assays. These results underline the utility of 3D-QSARs in peptide mimetic design and suggest that the properties of the unbound epitope are sufficient to capture most of the information to determine the cross-recognition.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Decision making techniques with similarity measures and OWA operators

We analyse the use of the ordered weighted average (OWA) in decision-making giving special attention to business and economic decision-making problems. We present several aggregation techniques that are very useful for decision-making such as the Hamming distance, the adequacy coefficient and the index of maximum and minimum level. We suggest a new approach by using immediate weights, that is, by using the weighted average and the OWA operator in the same formulation. We further generalize them by using generalized and quasi-arithmetic means. We also analyse the applicability of the OWA operator in business and economics and we see that we can use it instead of the weighted average. We end the paper with an application in a business multi-person decision-making problem regarding production management

Développement d'un Test Sérologique Contre le Virus de la Chorioméningite Lymphocytaire

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).

Sequence similarity between the viral cp gene and the transgene in transgenic papayas

The Papaya ringspot virus (PRSV) coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89%) to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in 'SunUp'. The objective of this work was to evaluate the degree of sequence similarity between the cp gene in the challenge isolate and the cp transgene in transgenic papayas resistant to PRSV. The production of a hybrid virus containing the genome backbone of PRSV HA up to the Apa I site in the NIb gene, and downstream from there, the sequence of PRSV TH was undertaken. This hybrid virus, PRSV HA/TH, was obtained and used to challenge 'Rainbow', 'SunUp', and an R2 population derived from line 63-1, all resistant to PRSV HA. PRSV HA/TH broke down the resistance in both papaya varieties and in the 63-1 population, demonstrating that sequence similarity is a major factor in the mechanism of resistance used by transgenic papayas expressing the cp gene. A comparative analysis of the cp gene present in line 55-1 and 63-1-derived transgenic plants and in PRSV HA, BR, and TH was also performed.

The QUASAR reproducibility study, Part II: Results from a multi-center Arterial Spin Labeling test-retest study.

Arterial Spin Labeling (ASL) is a method to measure perfusion using magnetically labeled blood water as an endogenous tracer. Being fully non-invasive, this technique is attractive for longitudinal studies of cerebral blood flow in healthy and diseased individuals, or as a surrogate marker of metabolism. So far, ASL has been restricted mostly to specialist centers due to a generally low SNR of the method and potential issues with user-dependent analysis needed to obtain quantitative measurement of cerebral blood flow (CBF). Here, we evaluated a particular implementation of ASL (called Quantitative STAR labeling of Arterial Regions or QUASAR), a method providing user independent quantification of CBF in a large test-retest study across sites from around the world, dubbed "The QUASAR reproducibility study". Altogether, 28 sites located in Asia, Europe and North America participated and a total of 284 healthy volunteers were scanned. Minimal operator dependence was assured by using an automatic planning tool and its accuracy and potential usefulness in multi-center trials was evaluated as well. Accurate repositioning between sessions was achieved with the automatic planning tool showing mean displacements of 1.87+/-0.95 mm and rotations of 1.56+/-0.66 degrees . Mean gray matter CBF was 47.4+/-7.5 [ml/100 g/min] with a between-subject standard variation SD(b)=5.5 [ml/100 g/min] and a within-subject standard deviation SD(w)=4.7 [ml/100 g/min]. The corresponding repeatability was 13.0 [ml/100 g/min] and was found to be within the range of previous studies.

Genetic variability of the Brazilian hair sheep breeds

The objectives of this work were to investigate the genetic structure of the Brazilian hair sheep breeds and to determine the origin of the Santa Inês breed. Molecular similarity was determined using Randomly Amplified Polymorphic DNA - Polymerase Chain Reaction markers in 238 individuals from five naturalized sheep breeds: Santa Inês (48 animals), Rabo Largo (48), Somali (48), Morada Nova (48) and Bergamasca (46), collected in Goiás, Sergipe, Bahia, and Ceará States as well as in the Federal District. Fifty-four loci were selected from 19 primers, after a pilot test using 140 primers. Qualitative analyses indicate diagnostic markers for all breeds. All breeds were significantly different from each other. Interbreed differences were explained by 14.92% of the total variation. Santa Inês clustered with Bergamasca (97% bootstrap) and with Rabo Largo, composing the third member of the group (81% bootstrap) while Morada Nova and Somali breeds clustered separately. Each breed should be considered as a separate management and conservation unit, and special care should be taken with Rabo Largo, Morada Nova and Somali breeds, represented by small herds in Brazil.

Concrete Pavement Mixture Design and Analysis (MDA): Development and Evaluation of Vibrating Kelly Ball Test (VKelly Test) for the Workability of Concrete, 2015

Due to the low workability of slipform concrete mixtures, the science of rheology is not strictly applicable for such concrete. However, the concept of rheological behavior may still be considered useful. A novel workability test method (Vibrating Kelly Ball or VKelly test) that would quantitatively assess the responsiveness of a dry concrete mixture to vibration, as is desired of a mixture suitable for slipform paving, was developed and evaluated. The objectives of this test method are for it to be cost-effective, portable, and repeatable while reporting the suitability of a mixture for use in slipform paving. The work to evaluate and refine the test was conducted in three phases: 1. Assess whether the VKelly test can signal variations in laboratory mixtures with a range of materials and proportions 2. Run the VKelly test in the field at a number of construction sites 3. Validate the VKelly test results using the Box Test developed at Oklahoma State University for slipform paving concrete The data collected to date indicate that the VKelly test appears to be suitable for assessing a mixture’s response to vibration (workability) with a low multiple operator variability. A unique parameter, VKelly Index, is introduced and defined that seems to indicate that a mixture is suitable for slipform paving when it falls in the range of 0.8 to 1.2 in./√s.

Teaching Motivational Interviewing to Medical Students to Improve Behavior Change Counseling Skills - Results of a Pilot Test

BACKGROUND: Patient behavior accounts for half or more of the variance in health, disease, mortality and treatment outcome and costs. Counseling using motivational interviewing (MI) effectively improves the substance use and medical compliance behavior of patients. Medical training should include substantial focus on this key issue of health promotion. The objective of the study is to test the efficacy of teaching MI to medical students. METHODS: Thirteen fourth-year medical students volunteered to participate. Seven days before and after an 8-hour interactive MI training workshop, each student performed a video-recorded interview with two standardized patients: a 60 year-old alcohol dependent female consulting a primary care physician for the first time about fatigue and depression symptoms; and a 50 year-old male cigarette smoker hospitalized for myocardial infarction. All 52 videos (13 students×2 interviews before and after training) were independently coded by two blinded clinicians using the Motivational Interviewing Training Integrity (MITI, 3.0). MITI scores consist of global spirit (Evocation, Collaboration, Autonomy/Support), global Empathy and Direction, and behavior count summary scores (% Open questions, Reflection to question ratio, % Complex reflections, % MI-adherent behaviors). A "beginning proficiency" threshold (BPT) is defined for each of these 9 scores. The proportion of students reaching BPT before and after training was compared using McNemar exact tests. Inter-rater reliability was evaluated by comparing double coding, and test-retest analyses were conducted on a sub-sample of 10 consecutive interviews by each coder. Weighted Kappas were used for global rating scales and intra-class correlations (ICC) were computed for behavior count summary scores. RESULTS: The percent of counselors reaching BPT before and after MI training increased significantly for Evocation (15% to 65%, p<.001), Collaboration (27% to 77%, p=.001), Autonomy/Support (15% to 54%, p=.006), and % Open questions (4% to 38%, p=.004). Proportions increased, but were not statistically significant for Empathy (38% to 58%, p=.18), Reflection to question ratio (0% to 15%, p=.12), % Complex reflection (35% to 54%, p=.23), and % MI-adherent behaviors (8% to 15%, p=.69). There was virtually no change for the Direction scale (92% to 88%, p=1.00). The reliability analyses produced mixed results. Weighted kappas for inter-rater reliability ranged from .14 for Direction to .51 for Collaboration, and from .27 for Direction to .80 for Empathy for test-retest. ICCs ranged from .20 for Complex reflections to .89 for Open questions (inter-rater), and from .67 for Complex reflections to .99 for Reflection to question ratio (test-retest). CONCLUSION: This pilot study indicates that a single 8-hour training in motivational interviewing for voluntary fourth-year medical students results in significant improvement of some MI skills. A larger sample of randomly selected medical students observed over longer periods should be studied to test if MI training generalizes to medical students. Inter-rater reliability and test-retest findings indicate a need for caution when interpreting the present results, as well as for more intensive training to help appropriately capture more dimensions of the process in future studies.