999 resultados para Seismic test
Resumo:
Background: Detection rates for adenoma and early colorectal cancer (CRC) are unsatisfactory due to low compliance towards invasive screening procedures such as colonoscopy. There is a large unmet screening need calling for an accurate, non-invasive and cost-effective test to screen for early neoplastic and pre-neoplastic lesions. Our goal is to identify effective biomarker combinations to develop a screening test aimed at detecting precancerous lesions and early CRC stages, based on a multigene assay performed on peripheral blood mononuclear cells (PBMC).Methods: A pilot study was conducted on 92 subjects. Colonoscopy revealed 21 CRC, 30 adenomas larger than 1 cm and 41 healthy controls. A panel of 103 biomarkers was selected by two approaches: a candidate gene approach based on literature review and whole transcriptome analysis of a subset of this cohort by Illumina TAG profiling. Blood samples were taken from each patient and PBMC purified. Total RNA was extracted and the 103 biomarkers were tested by multiplex RT-qPCR on the cohort. Different univariate and multivariate statistical methods were applied on the PCR data and 60 biomarkers, with significant p-value (< 0.01) for most of the methods, were selected.Results: The 60 biomarkers are involved in several different biological functions, such as cell adhesion, cell motility, cell signaling, cell proliferation, development and cancer. Two distinct molecular signatures derived from the biomarker combinations were established based on penalized logistic regression to separate patients without lesion from those with CRC or adenoma. These signatures were validated using bootstrapping method, leading to a separation of patients without lesion from those with CRC (Se 67%, Sp 93%, AUC 0.87) and from those with adenoma larger than 1cm (Se 63%, Sp 83%, AUC 0.77). In addition, the organ and disease specificity of these signatures was confirmed by means of patients with other cancer types and inflammatory bowel diseases.Conclusions: The two defined biomarker combinations effectively detect the presence of CRC and adenomas larger than 1 cm with high sensitivity and specificity. A prospective, multicentric, pivotal study is underway in order to validate these results in a larger cohort.
Resumo:
Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.
Resumo:
OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.
Resumo:
Estimation of the spatial statistics of subsurface velocity heterogeneity from surface-based geophysical reflection survey data is a problem of significant interest in seismic and ground-penetrating radar (GPR) research. A method to effectively address this problem has been recently presented, but our knowledge regarding the resolution of the estimated parameters is still inadequate. Here we examine this issue using an analytical approach that is based on the realistic assumption that the subsurface velocity structure can be characterized as a band-limited scale-invariant medium. Our work importantly confirms recent numerical findings that the inversion of seismic or GPR reflection data for the geostatistical properties of the probed subsurface region is sensitive to the aspect ratio of the velocity heterogeneity and to the decay of its power spectrum, but not to the individual values of the horizontal and vertical correlation lengths.
Resumo:
Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.
Resumo:
The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.
Resumo:
The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.
Resumo:
In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.
Resumo:
Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen
Resumo:
A defining characteristic of fractured rocks is their very high level of seismic attenuation, which so far has been assumed to be mainly due to wave-induced fluid flow (WIFF) between the fractures and the pore space of the embedding matrix. Using oscillatory compressibility simulations based on the quasi-static poroelastic equations, we show that another important, and as of yet undocumented, manifestation of WIFF is at play in the presence of fracture connectivity. This additional energy loss is predominantly due to fluid flow within the connected fractures and is sensitive to their lengths, permeabilities, and intersection angles. Correspondingly, it contains key information on the governing hydraulic properties of fractured rock masses and hence should be accounted for whenever realistic seismic models of such media are needed.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.
Resumo:
Uplift gradients can provide the location of highly strained zones, which can be considered to be seismic. The Turan block (Central Asia) contains zones with high gradient of uplift velocities, above the threshold 0.04mm km-1year-1. Some of these zones are associated with important seismic activity and others are not correlated with any recent important recorded earthquakes, however, recent faults scarps as well as diverted rivers may indicate a recent tectonic activity. This threshold of gradient is probably a significant rheologic property of the upper crust. On the basis of these considerations the Uzboy river area is proposed as a potential high seismic hazard zone.
Resumo:
Joint inversion of crosshole ground-penetrating radar and seismic data can improve model resolution and fidelity of the resultant individual models. Model coupling obtained by minimizing or penalizing some measure of structural dissimilarity between models appears to be the most versatile approach because only weak assumptions about petrophysical relationships are required. Nevertheless, experimental results and petrophysical arguments suggest that when porosity variations are weak in saturated unconsolidated environments, then radar wave speed is approximately linearly related to seismic wave speed. Under such circumstances, model coupling also can be achieved by incorporating cross-covariances in the model regularization. In two case studies, structural similarity is imposed by penalizing models for which the model cross-gradients are nonzero. A first case study demonstrates improvements in model resolution by comparing the resulting models with borehole information, whereas a second case study uses point-spread functions. Although radar seismic wavespeed crossplots are very similar for the two case studies, the models plot in different portions of the graph, suggesting variances in porosity. Both examples display a close, quasilinear relationship between radar seismic wave speed in unconsolidated environments that is described rather well by the corresponding lower Hashin-Shtrikman (HS) bounds. Combining crossplots of the joint inversion models with HS bounds can constrain porosity and pore structure better than individual inversion results can.