917 resultados para Regulatory rationality
Resumo:
Embryonic-maternal interaction from the earliest stages of gestation has a key, sustained role in neurologic development, persisting into adulthood. Early adverse events may be detrimental in adulthood. Protective factors present during gestation could significantly impact post-natal therapy. The role of PreImplantation Factor (PIF) within this context is herein examined. Secreted by viable early embryos, PIF establishes effective embryonic-maternal communication and exerts essential trophic and protective roles by reducing oxidative stress and protein misfolding and by blunting the nocive let-7 microRNA related pathway. PIF's effects on systemic immunity lead to comprehensive immune modulation, not immune suppression. We examine PIF's role in protecting embryos from adverse maternal environment, which can lead to neurological disorders that may only manifest post-nataly: Synthetic PIF successfully translates endogenous PIF features in both pregnant and non-pregnant clinically relevant models. Specifically PIF has neuroprotective effects in neonatal prematurity. In adult relapsing-remitting neuroinflammation, PIF reverses advanced paralysis while promoting neurogenesis. PIF reversed Mycobacterium smegmatis induced brain infection. In graft-vs.-host disease, PIF reduced skin ulceration, liver inflammation and colon ulceration while maintaining beneficial anti-cancer, graft-vs.-leukemia effect. Clinical-grade PIF has high-safety profile even at supraphysiological doses. The FDA awarded Fast-Track designation, and university-sponsored clinical trials for autoimmune disorder are ongoing. Altogether, PIF properties point to its determining regulatory role in immunity, inflammation and transplant acceptance. Specific plans for using PIF for the treatment of complex neurological disorders (ie. traumatic brain injury, progressive paralysis), including neuroprotection from newborn to adult, are presented.
Resumo:
PROBLEM Given the important role of regulatory T cells (Treg) for successful pregnancy, the ability of soluble maternal and fetal pregnancy factors to induce human Treg was investigated. METHOD OF STUDY Peripheral blood mononuclear cells (PBMCs) or isolated CD4+CD25‒ cells were cultured in the presence of pooled second or third trimester pregnancy sera, steroid hormones or supernatants from placental explants, and the numbers and function of induced CD4+CD25+FOXP3+ Treg were analysed. RESULTS Third trimester pregnancy sera and supernatants of early placental explants, but not sex steroid hormones, induced an increase of Tregs from PBMCs. Early placental supernatant containing high levels of tumour necrosis factor-α, interferon-γ, interleukins -1, -6 and -17, soluble human leucocyte antigen-G, and transforming growth factor-β1, increased the proportion of Treg most effectively and was able to induce interleukin-10-secreting-Treg from CD4+CD25‒cells. CONCLUSIONS Compared with circulating maternal factors, placental- and fetal-derived factors appear to exert a more powerful effect on numerical changes of Treg, thereby supporting fetomaternal tolerance during human pregnancy.
Resumo:
Apoptosis plays an important role in intervertebral disc degeneration (IDD). Overwhelming evidence indicates that RASSF7 is essential for cell growth and apoptosis. Recently, it has been noted that the JNK signaling can be negatively regulated by suppressing phosphorylated-MKK7 activation during pro-apoptosis. We aimed to investigate the RASSF7 expression level in human degenerative nucleus pulposus (NP) cells and non-degenerative NP cells and the link between RASSF7-JNK with NP cells apoptosis. We harvested NP tissues from 20 IDD patients as disease group and 8 cadaveric donors as normal controls. We detected RASSF7 expression by Real-time-PCR and western blotting. Consequently, we found that the expression of RASSF7 was higher in non-degenerative group than in degenerative group (P<0.05). Overexpression of RASSF7 in degenerative NP cells led to decreased apoptosis rate than that in scramble group (P<0.05). Collectively, our findings suggest that RASSF7 plays an important role in human IDD and RASSF7 might be potentially developed as a curative agent.
Resumo:
Employment-related policies are sensitive by any standard, and they remain basically national despite international labour standards (ILS) being even older than the United Nations. Globalization is changing this situation where countries may have to choose between ‘more’ or ‘better’ jobs. The multilateral framework of the World Trade Organization (WTO) can only have an indirect impact. But Regional Trade Agreements (RTA) and International Investment Agreements (IIA) are emerging as a new way of gradually enhancing the impact of certain labour standards. In addition, unilateral measures both by governments and importers driven by social and environmental consumer preferences and pressure groups increasingly shape the international regulatory framework for national employment policies. Even small, locally operating enterprises risk marginalization and market exclusion by ignoring these developments. The long-term influence of this new ‘network approach’ on employment-related policies, including job location, gender issues, social coherence and migration remains to be seen. Nonetheless, the still flimsy evidence gathered here seems to indicate that this new, international framework might increase sustainable employment where and when supporting measures, including through unilateral preferences and even sanctions, form a ‘cocktail’ which export-oriented industries and their suppliers will find palatable.
Resumo:
Induction of cell-autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However, the detailed mechanism mediating this process remains enigmatic. In this study, we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (irradiation-responsive enhancer region). The IRER mediates the expression of surrounding proapoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In a previous work, we showed that the IRER also mediates P53-dependent induction of proapoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53- and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress.
Resumo:
To understand how a eukaryote achieves differential transcription of genes in precise spatial patterns, the molecular details of tissue specific expression of the Strongylocentrotus purpuratus Spec2a gene were investigated by functional studies of the cis-regulatory components in the upstream enhancer. Regional activation of Spec2a in the aboral ectoderm is conferred by a combination of activators and repressors. The positive regulators include previously identified SpOtx and a trans-regulatory factor binding at the CCAAT site in the Spec2a enhancer. The nuclear protein binding to the CCAAT box was determined to be the heterotrimeric CCAAT binding factor (SpCBF). SpCBF also mediates general activation in the ectoderm. The negative regulators consist of an oral ectoderm repressor (OER), an endoderm repressor (ENR), and an S. Purpuratus goosecoid homologue (SpGsc). OER functions to prevent expression in the oral ectoderm, while ENR is required to repress endoderm expression. SpGsc antagonizes the SpOtx function by competing for binding at SpOtx target genes in oral ectoderm, where it functions as an active repressor. Thus, SpOtx and SpGsc perform collectively to establish and maintain the oral-aboral axis. Finally, purification of ENR and OER proteins from sea urchin blastula stage nuclear extracts was performed using site-specific DNA-affmity chromatography. ^
Resumo:
Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^
Macroeconomic Rationality and Lucas' Misperceptions Model: Further Evidence from Forty-One Countries
Resumo:
Several researchers have examined Lucas's misperceptions model as well as various propositions derived from it within a cross-section empirical framework. The cross-section approach imposes a single monetary policy regime for the entire period. Our paper innovates on existing tests of those rational expectations propositions by allowing the simultaneous effect of monetary and short run aggregate supply (oil price) shocks on output behavior and the employment of advanced panel econometric techniques. Our empirical findings, for a sample of 41 countries over 1949 to 1999, provide evidence in favor of the majority of rational expectations propositions.
Resumo:
Regulatory T cells expressing the fork-head box transcription factor 3 (Foxp3) play a central role in the dominant control of immunological tolerance. Compelling evidence obtained from both animal and clinical studies have now linked the expansion and accumulation of Foxp3+ regulatory T cells associated with tumor lesions to the failure of immune-mediated tumor rejection. However, further progress of the field is hampered by the gap of knowledge regarding their phenotypic, functional, and the developmental origins in which these tumor-associated Foxp3+ regulatory T cells are derived. Here, we have characterized the general properties of tumor-associated Foxp3+ regulatory T cells and addressed the issue of tumor microenvironment mediated de-novo induction by utilizing a well known murine tumor model MCA-205 in combination with our BAC Foxp3-GFP reporter mice and OT-II TCR transgenic mice on the RAG deficient background (RAG OT-II). De-novo induction defines a distinct mechanism of converting non-regulatory precursor cells to Foxp3+ regulatory T cells in the periphery as opposed to the expansion of pre-existing regulatory T cells formed naturally during thymic T cell development. This mechanism is of particularly importance to how tumors induce tumor-antigen-specific suppressor cells to subvert anti-tumor immune responses. Our study has found that tumor-associated Foxp3+ regulatory T cells are highly activated, undergo vigorous proliferation, are more potent by in-vitro suppression assays, and express higher levels of membrane-bound TGF-β1 than non-tumor regulatory T cells. With Foxp3-GFP reporter mice or RAG OT-II TCR transgenic mice, we show that tumor tissue can induce detectable de-novo generation of Foxp3+ regulatory T cells of both polyclonal or antigen specific naïve T cells. This process was not only limited for subcutaneous tumors but for lung tumors as well. Furthermore, this process required the inducing antigen to be co-localized within the tumor tissue. Examination of tumor tissue revealed an abundance of myeloid CD11b+ antigen-presenting cells that were capable of inducing Foxp3+ regulatory T cells. Taken together, these findings elucidate the general attributes and origins of tumor-associated Foxp3+ regulatory T cells in the tumor microenvironment and in their role in the negative regulation of tumor immunity.^
Resumo:
Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^
Resumo:
Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^