997 resultados para RT-LAB simulation
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Utilization of light and illumination systems in automotive industry for different purposes has been increased significantly in recent years. Volvo as one of the leading companies in manufacturing of luxury cars has found the great capacity in this area. The performance of such an illumination systems is one of the challenges that engineers in this industry are facing with. In this study an effort has been made to design a system to make the iron mark of Volvo being illuminated and the system is being evaluated by optics simulation in software using Ray optics method. At the end, results are assessed and some optimizations are carried out. Different kind of light guides, front side of the iron mark and some possible arrangement for LED also evaluated and different materials tested. The best combination from uniformity, color and amount of luminance aspect selected as a possible solution for this special project which can be used as a base for further studies in Volvo.
Resumo:
Global energy consumption has been increasing yearly and a big portion of it is used in rotating electrical machineries. It is clear that in these machines energy should be used efficiently. In this dissertation the aim is to improve the design process of high-speed electrical machines especially from the mechanical engineering perspective in order to achieve more reliable and efficient machines. The design process of high-speed machines is challenging due to high demands and several interactions between different engineering disciplines such as mechanical, electrical and energy engineering. A multidisciplinary design flow chart for a specific type of high-speed machine in which computer simulation is utilized is proposed. In addition to utilizing simulation parallel with the design process, two simulation studies are presented. The first is used to find the limits of two ball bearing models. The second is used to study the improvement of machine load capacity in a compressor application to exceed the limits of current machinery. The proposed flow chart and simulation studies show clearly that improvements in the high-speed machinery design process can be achieved. Engineers designing in high-speed machines can utilize the flow chart and simulation results as a guideline during the design phase to achieve more reliable and efficient machines that use energy efficiently in required different operation conditions.
Resumo:
The objective of the work is to study the flow behavior and to support the design of air cleaner by dynamic simulation.In a paper printing industry, it is necessary to monitor the quality of paper when the paper is being produced. During the production, the quality of the paper can be monitored by camera. Therefore, it is necessary to keep the camera lens clean as wood particles may fall from the paper and lie on the camera lens. In this work, the behavior of the air flow and effect of the airflow on the particles at different inlet angles are simulated. Geometries of a different inlet angles of single-channel and double-channel case were constructed using ANSYS CFD Software. All the simulations were performed in ANSYS Fluent. The simulation results of single-channel and double-channel case revealed significant differences in the behavior of the flow and the particle velocity. The main conclusion from this work are in following. 1) For the single channel case the best angle was 0 degree because in that case, the air flow can keep 60% of the particles away from the lens which would otherwise stay on lens. 2) For the double channel case, the best solution was found when the angle of the first inlet was 0 degree and the angle of second inlet was 45 degree . In that case, the airflow can keep 91% of particles away from the lens which would otherwise stay on lens.
Resumo:
This dissertation describes an approach for developing a real-time simulation for working mobile vehicles based on multibody modeling. The use of multibody modeling allows comprehensive description of the constrained motion of the mechanical systems involved and permits real-time solving of the equations of motion. By carefully selecting the multibody formulation method to be used, it is possible to increase the accuracy of the multibody model while at the same time solving equations of motion in real-time. In this study, a multibody procedure based on semi-recursive and augmented Lagrangian methods for real-time dynamic simulation application is studied in detail. In the semirecursive approach, a velocity transformation matrix is introduced to describe the dependent coordinates into relative (joint) coordinates, which reduces the size of the generalized coordinates. The augmented Lagrangian method is based on usage of global coordinates and, in that method, constraints are accounted using an iterative process. A multibody system can be modelled as either rigid or flexible bodies. When using flexible bodies, the system can be described using a floating frame of reference formulation. In this method, the deformation mode needed can be obtained from the finite element model. As the finite element model typically involves large number of degrees of freedom, reduced number of deformation modes can be obtained by employing model order reduction method such as Guyan reduction, Craig-Bampton method and Krylov subspace as shown in this study The constrained motion of the working mobile vehicles is actuated by the force from the hydraulic actuator. In this study, the hydraulic system is modeled using lumped fluid theory, in which the hydraulic circuit is divided into volumes. In this approach, the pressure wave propagation in the hoses and pipes is neglected. The contact modeling is divided into two stages: contact detection and contact response. Contact detection determines when and where the contact occurs, and contact response provides the force acting at the collision point. The friction between tire and ground is modelled using the LuGre friction model, which describes the frictional force between two surfaces. Typically, the equations of motion are solved in the full matrices format, where the sparsity of the matrices is not considered. Increasing the number of bodies and constraint equations leads to the system matrices becoming large and sparse in structure. To increase the computational efficiency, a technique for solution of sparse matrices is proposed in this dissertation and its implementation demonstrated. To assess the computing efficiency, augmented Lagrangian and semi-recursive methods are implemented employing a sparse matrix technique. From the numerical example, the results show that the proposed approach is applicable and produced appropriate results within the real-time period.
Resumo:
The aim of this master's thesis is to develop a two-dimensional drift-di usion model, which describes charge transport in organic solar cells. The main bene t of a two-dimensional model compared to a one-dimensional one is the inclusion of the nanoscale morphology of the active layer of a bulk heterojunction solar cell. The developed model was used to study recombination dynamics at the donor-acceptor interface. In some cases, it was possible to determine e ective parameters, which reproduce the results of the two-dimensional model in the one-dimensional case. A summary of the theory of charge transport in semiconductors was presented and discussed in the context of organic materials. Additionally, the normalization and discretization procedures required to nd a numerical solution to the charge transport problem were outlined. The charge transport problem was solved by implementing an iterative scheme called successive over-relaxation. The obtained solution is given as position-dependent electric potential, free charge carrier concentrations and current densities in the active layer. An interfacial layer, separating the pure phases, was introduced in order to describe charge dynamics occurring at the interface between the donor and acceptor. For simplicity, an e ective generation of free charge carriers in the interfacial layer was implemented. The pure phases simply act as transport layers for the photogenerated charges. Langevin recombination was assumed in the two-dimensional model and an analysis of the apparent recombination rate in the one-dimensional case is presented. The recombination rate in a two-dimensional model is seen to e ectively look like reduced Langevin recombination at open circuit. Replicating the J-U curves obtained in the two-dimensional model is, however, not possible by introducing a constant reduction factor in the Langevin recombination rate. The impact of an acceptor domain in the pure donor phase was investigated. Two cases were considered, one where the acceptor domain is isolated and another where it is connected to the bulk of the acceptor. A comparison to the case where no isolated domains exist was done in order to quantify the observed reduction in the photocurrent. The results show that all charges generated at the isolated domain are lost to recombination, but the domain does not have a major impact on charge transport. Trap-assisted recombination at interfacial trap states was investigated, as well as the surface dipole caused by the trapped charges. A theoretical expression for the ideality factor n_id as a function of generation was derived and shown to agree with simulation data. When the theoretical expression was fitted to simulation data, no interface dipole was observed.
Resumo:
The aim of this research is to develop a tool that could allow to organize coopetitional relationships between organizations on the basis of two-sided Internet platform. The main result of current master thesis is a detailed description of the concept of the lead generating internet platform-based coopetition. With the tools of agent-based modelling and simulation, there were obtained results that could be used as a base for suggestion that the developed concept is able to cause a positive effect on some particular industries (e.g. web-design studios market) and potentially can bring some benefits and extra profitability for most companies that operate on this particular industry. Also on the basis of the results it can be assumed that the developed instrument is also able to increase the degree of transparency of the market to which it is applied.
Resumo:
Comprend : Notice sur Louise Labé ; Dialogue entre Sappho et Louise Labé
Resumo:
Several recent studies have described the period of impaired alertness and performance known as sleep inertia that occurs upon awakening from a full night of sleep. They report that sleep inertia dissipates in a saturating exponential manner, the exact time course being task dependent, but generally persisting for one to two hours. A number of factors, including sleep architecture, sleep depth and circadian variables are also thought to affect the duration and intensity. The present study sought to replicate their findings for subjective alertness and reaction time and also to examine electrophysiological changes through the use of event-related potentials (ERPs). Secondly, several sleep parameters were examined for potential effects on the initial intensity of sleep inertia. Ten participants spent two consecutive nights and subsequent mornings in the sleep lab. Sleep architecture was recorded for a fiiU nocturnal episode of sleep based on participants' habitual sleep patterns. Subjective alertness and performance was measured for a 90-minute period after awakening. Alertness was measured every five minutes using the Stanford Sleepiness Scale (SSS) and a visual analogue scale (VAS) of sleepiness. An auditory tone also served as the target stimulus for an oddball task designed to examine the NlOO and P300 components ofthe ERP waveform. The five-minute oddball task was presented at 15-minute intervals over the initial 90-minutes after awakening to obtain six measures of average RT and amplitude and latency for NlOO and P300. Standard polysomnographic recording were used to obtain digital EEG and describe the night of sleep. Power spectral analyses (FFT) were used to calculate slow wave activity (SWA) as a measure of sleep depth for the whole night, 90-minutes before awakening and five minutes before awakening.
Resumo:
The Robocup Rescue Simulation System (RCRSS) is a dynamic system of multi-agent interaction, simulating a large-scale urban disaster scenario. Teams of rescue agents are charged with the tasks of minimizing civilian casualties and infrastructure damage while competing against limitations on time, communication, and awareness. This thesis provides the first known attempt of applying Genetic Programming (GP) to the development of behaviours necessary to perform well in the RCRSS. Specifically, this thesis studies the suitability of GP to evolve the operational behaviours required of each type of rescue agent in the RCRSS. The system developed is evaluated in terms of the consistency with which expected solutions are the target of convergence as well as by comparison to previous competition results. The results indicate that GP is capable of converging to some forms of expected behaviour, but that additional evolution in strategizing behaviours must be performed in order to become competitive. An enhancement to the standard GP algorithm is proposed which is shown to simplify the initial search space allowing evolution to occur much quicker. In addition, two forms of population are employed and compared in terms of their apparent effects on the evolution of control structures for intelligent rescue agents. The first is a single population in which each individual is comprised of three distinct trees for the respective control of three types of agents, the second is a set of three co-evolving subpopulations one for each type of agent. Multiple populations of cooperating individuals appear to achieve higher proficiencies in training, but testing on unseen instances raises the issue of overfitting.
Resumo:
This study has two main objectives. First, the phlebotomy process at the St. Catharines Site of the Niagara Health System is investigated, which starts when an order for a blood test is placed, and ends when the specimen arrives at the lab. The performance measurement is the flow time of the process, which reflects concerns and interests of both the hospital and the patients. Three popular operational methodologies are applied to reduce the flow time and improve the process: DMAIC from Six Sigma, lean principles and simulation modeling. Potential suggestions are provided for the St. Catharines Site, which could result in an average of seven minutes reduction in the flow time. The second objective addresses the fact that these three methodologies have not been combined before in a process improvement effort. A structured framework combining them is developed to benefit future study of phlebotomy and other hospital processes.