930 resultados para Neutron scattering and diffraction
Resumo:
White dwarfs (WDs) are electron-degenerate structures that are commonly assumed to evolve via a pure cooling process, with no stable thermonuclear activity at work. Their cooling rate is adopted as a cosmic chronometer to constrain the age of several Galactic populations, including the disk, Globular Clusters (GCs) and open clusters. This thesis work is aimed at the study of the WD populations in globular clusters and is articulated in two branches. The first was focused on the study of the bright portion of the WD cooling sequence. By analyzing high resolution UV data acquired with the Hubble Space Telescope (HST), we compared the WD luminosity functions (LFs) in four Galactic GCs (namely M13, M3, NGC6752, and M5) finding an unexpected over-abundance of WDs in M13 and NGC6752 with respect to M3 and M5. Theoretical models suggest that, consistently with the blue-tail horizontal branch (HB) morphology of M13 and NGC6752, this overabundance is due to a population of slowly cooling WDs, i.e., WDs fading more slowly than in a pure cooling process thanks to an extra-energy source provided by stable thermonuclear burning in their residual hydrogen-rich envelope. This is the first empirical evidence of WDs fading at a slower rate than usually assumed, and has a crucial impact on the use of the cooling sequence as a cosmic chronometer. The second branch was focused on the search for the companion star to binary millisecond Pulsars (MSP) in the globular clusters M13 and NGC 6652: the identified companions turned out to be helium-core WDs, and provided a invaluable constraints on the mass of the neutron star and the epoch of the MSP formation.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Low-temperature (15 K) single-crystal neutron-diffraction structures and Raman spectra of the salts (NX4)(2)[CU(OX2)(6)](SO4)(2), where X = H or D, are reported. This study is concerned with the origin of the structural phase change that is known to occur upon deuteration. Data for the deuterated salt were measured in the metastable state, achieved by application of 500 bar of hydrostatic pressure at similar to303 K followed by cooling to 281 K and the subsequent release of pressure. This allows for the direct comparison between the hydrogenous and deuterated salts, in the same modification, at ambient pressure and low temperature. The Raman spectra provide no intimation of any significant change in the intermolecular bonding. Furthermore, structural differences are few, the largest being for the long Cu-O bond, which is 2.2834(5) and 2.2802(4) Angstrom for the hydrogenous and the deuterated salts, respectively. Calorimetric data for the deuterated salt are also presented, providing an estimate of 0.17(2) kJ/mol for the enthalpy difference between the two structural forms at 295.8(5) K. The structural data suggest that substitution of hydrogen for deuterium gives rise to changes in the hydrogen-bonding interactions that result in a slightly reduced force field about the copper(II) center. The small structural differences suggest different relative stabilities for the hydrogenous and deuterated salts, which may be sufficient to stabilize the hydrogenous salt in the anomalous structural form.
Resumo:
Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.
Resumo:
Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.
Resumo:
Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.
Resumo:
A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Neutron diffraction data of DyCrO4 oxide, prepared at 4 GPa and 833 K from the ambient pressure zircon-type, reveal that crystallize with the scheelite-type structure, space group I41/a. Accompanying this structural phase transition induced by pressure the magnetic properties change dramatically from ferromagnetism in the case of zircon to antiferromagnetism for the scheelite polymorph with a T N= 19 K. The analysis of the neutron diffraction data obtained at 1.2 K has been used to determine the magnetic structure of this DyCrO4-scheelite oxide which can be described with a k = [0, 0, 0] as propagation vector, where the Dy and Cr moments are lying in the ab-plane of the scheelite structure. The ordered magnetic moments are 10 µB and 1 µB for Dy+3 and Cr+5 respectively
Resumo:
Cover title.