Normal skin of HIV-infected individuals contains increased numbers of dermal CD8 T cells and normal numbers of Langerhans cells

Dysregulation of the skin immune system (SIS) could explain the high prevalence of skin disorders in HIV+ individuals. The present study was carried out to determine whether alterations in the cell population of SIS and epidermal immunoactivation occur in the normal skin of HIV+ individuals. Forty-five biopsies were taken from the normal upper arm skin of 45 HIV+ patients and of 15 healthy controls. HIV+ individuals were divided into three categories according to their CD4 cell blood count (<200, 200-499 and ³500/µl). Hematoxylin-eosin was used to stain tissue sections for morphological analysis and immunohistochemistry was used for the evaluation of the frequency of macrophages, Langerhans cells, and CD lymphocyte subsets. In addition, semiquantitative analysis of LFA-1, ICAM-1 and HLA-DR was determined in epidermal cells. Macrophages, Langerhans cells, and CD lymphocyte subsets did not differ significantly between any of the patient categories and the control group. When all HIV+ individuals were compared as a group to the control group, a significant increase in dermal CD8+ T lymphocytes (P < 0.01) and lower CD4-CD8 ratios (P < 0.01) were observed in the HIV+ individuals. Epidermal ICAM-1 and HLA-DR expression was negative in both HIV+ and normal skin biopsies. No evidence of a depletion of the SIS population or of epidermal immunoactivation in normal skin from HIV+ individuals was demonstrable, suggesting that alterations in the central immune system are not necessarily reflected in the SIS of HIV-infected patients.

Normal expression of IFN-gammaR in four patients with uncommon mycobacterial infection phenotypes

Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.

Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Mesopic radial frequency contrast sensitivity function for young and older adults

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Lipolysis of emulsion models of triglyceride-rich lipoproteins is altered in male patients with abdominal aorta aneurysm

Disorders of the lipid metabolism may play a role in the genesis of abdominal aorta aneurysm. The present study examined the intravascular catabolism of chylomicrons, the lipoproteins that carry the dietary lipids absorbed by the intestine in the circulation in patients with abdominal aorta aneurysm. Thirteen male patients (72 ± 5 years) with abdominal aorta aneurysm with normal plasma lipid profile and 13 healthy male control subjects (73 ± 5 years) participated in the study. The method of chylomicron-like emulsions was used to evaluate this metabolism. The emulsion labeled with 14C-cholesteryl oleate and ³H-triolein was injected intravenously in both groups. Blood samples were taken at regular intervals over 60 min to determine the decay curves. The fractional clearance rate (FCR) of the radioactive labels was calculated by compartmental analysis. The FCR of the emulsion with ³H-triolein was smaller in the aortic aneurysm patients than in controls (0.025 ± 0.017 vs 0.039 ± 0.019 min-1; P < 0.05), but the FCR of14C-cholesteryl oleate of both groups did not differ. In conclusion, as indicated by the triglyceride FCR, chylomicron lipolysis is diminished in male patients with aortic aneurysm, whereas the remnant removal which is traced by the cholesteryl oleate FCR is not altered. The results suggest that defects in the chylomicron metabolism may represent a risk factor for development of abdominal aortic aneurysm.

Demographic and metabolic characteristics of individuals with progressive glucose tolerance

We evaluated changes in glucose tolerance of 17 progressors and 62 non-progressors for 9 years to improve our understanding of the pathogenesis of type 2 diabetes mellitus. Changes in anthropometric measurements and responses to an oral glucose tolerance test (OGTT) were analyzed. We identified 14 pairs of individuals, one from each group, who were initially normal glucose tolerant and were matched for gender, age, weight, and girth. We compared initial plasma glucose and insulin curves (from OGTT), insulin secretion (first and second phases) and insulin sensitivity indices (from hyperglycemic clamp assay) for both groups. In the normal glucose tolerant phase, progressors presented: 1) a higher OGTT blood glucose response with hyperglycemia in the second hour and a similar insulin response vs non-progressors; 2) a reduced first-phase insulin secretion (2.0 ± 0.3 vs 2.3 ± 0.3 pmol/L; P < 0.02) with a similar insulin sensitivity index and a lower disposition index (3.9 ± 0.2 vs 4.1 ± 0.2 µmol·kg-1·min-1 ; P < 0.05) vs non-progressors. After 9 years, both groups presented similar increases in weight and fasting blood glucose levels and progressors had an increased glycemic response at 120 min (P < 0.05) and reduced early insulin response to OGTT (progressors, 1st: 2.10 ± 0.34 vs 2nd: 1.87 ± 0.25 pmol/mmol; non-progressors, 1st: 2.15 ± 0.28 vs 2nd: 2.03 ± 0.39 pmol/mmol; P < 0.05). Theses data suggest that β-cell dysfunction might be a risk factor for type 2 diabetes mellitus.

Normal flow-mediated vasodilatation of the brachial artery and carotid artery intima-media thickness in subclinical hypothyroidism

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Normal range values for thromboelastography in healthy adult volunteers

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

The role of micro-ribonucleic acids in normal hematopoiesis and leukemic T-lymphogenesis

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Exogenous normal lymph reduces liver injury induced by lipopolysaccharides in rats

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Acute but not chronic metabolic acidosis potentiates the acetylcholine-induced reduction in blood pressure: an endothelium-dependent effect

Metabolic acidosis has profound effects on vascular tone. This study investigated the in vivo effects of acute metabolic acidosis (AMA) and chronic metabolic acidosis (CMA) on hemodynamic parameters and endothelial function. CMA was induced by ad libitum intake of 1% NH4Cl for 7 days, and AMA was induced by a 3-h infusion of 6 M NH4Cl (1 mL/kg, diluted 1:10). Phenylephrine (Phe) and acetylcholine (Ach) dose-response curves were performed by venous infusion with simultaneous venous and arterial blood pressure monitoring. Plasma nitrite/nitrate (NOx) was measured by chemiluminescence. The CMA group had a blood pH of 7.15±0.03, which was associated with reduced bicarbonate (13.8±0.98 mmol/L) and no change in the partial pressure of arterial carbon dioxide (PaCO2). The AMA group had a pH of 7.20±0.01, which was associated with decreases in bicarbonate (10.8±0.54 mmol/L) and PaCO2 (47.8±2.54 to 23.2±0.74 mmHg) and accompanied by hyperventilation. Phe or ACh infusion did not affect arterial or venous blood pressure in the CMA group. However, the ACh infusion decreased the arterial blood pressure (ΔBP: -28.0±2.35 mm Hg [AMA] to -4.5±2.89 mmHg [control]) in the AMA group. Plasma NOx was normal after CMA but increased after AMA (25.3±0.88 to 31.3±0.54 μM). These results indicate that AMA, but not CMA, potentiated the Ach-induced decrease in blood pressure and led to an increase in plasma NOx, reinforcing the effect of pH imbalance on vascular tone and blood pressure control.

Estrutura dos grânulos de amido de milho normal e ceroso

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.