Solution structure of χ-conopeptide MrIA, a modulator of the human norepinephrine transporter

The chi-conopeptides MrIA and MrIB are 13-residue peptides with two disulfide bonds that inhibit human and rat norepinephrine transporter systems and are of significant interest for the design of novel drugs involved in pain treatment. In the current study we have determined the solution structure of MrIA using NMR spectroscopy. The major element of secondary structure is a hairpin with the two strands connected by an inverse gamma-turn. The residues primarily involved in activity have previously been shown to be located in the turn region (Sharpe, I. A.; Palant, E.: Schroder, C. L; Kaye, D. M.; Adams, D. I.; Alewood, P. F.; Lewis, R. J. J Biol Client 2003, 278, 40317-40323), which appears to be more flexible than the beta-strands based on disorder in the ensemble of calculated structures. Analogues of MrIA with N-terminal truncations indicate that the N-terminal residues play a role in defining a stable conformation and the native disulfide connectivity. In particular, noncovalent interactions between Val3 and Hypl2 are likely to be involved in maintaining a stable conformation. The N-terminus also affects activity, as a single N-terminal deletion introduced additional pharmacology at rat vas deferens, while deleting the first two amino acids reduced chi-conopeptide potency. This article was originally published online as an accepted preprint. The Published Online date corresponds to the preprint version. You can request a copy of the preprint by entailing the Biopolymers editorial office at biopolymers@wiley.com (c) 2005 Wiley Periodicals, Inc.

Genetic polymorphism in an inflammasome component, cervical mycoplasma detection and female infertility in women undergoing in vitro fertilization

The inflammasome is an inducible cytoplasmic structure that is responsible for production and release of biologically active interleukin-1 (IL-1). A polymorphism in the inflammasome component NALP3 has been associated with decreased IL-1 levels and increased occurrence of vaginal Candida infection. We hypothesized that this polymorphism-induced variation would influence susceptibility to infertility. DNA was obtained from 243 women who were undergoing in vitro fertilization (IVF) and tested for a length polymorphism in intron 2 of the gene coding for NALP3 (gene symbol CIAS1). At the conclusion of testing the findings were analyzed in relation to clinical parameters and IVF outcome. The frequency of the 12 unit repeat allele, associated with maximal inflammasome activity, was 62.3% in cases of female infertility vs. 75.6% in cases where only the male partner had a detectable fertility problem (p = 0.0095). Conversely, the frequency of the 7 unit repeat allele was 28.9% in those with a female fertility problem, 17.0% in women with infertile males and 18.4% in idiopathic infertility (p = 0.0124). Among the women who were cervical culture-positive for mycoplasma the frequency of the 7 unit repeat was 53.7% as opposed to 19.5% in those negative for this infection (p < 0.0001). We conclude that the CIAS1 7 unit repeat polymorphism increases the likelihood of mycoplasma infection-associated female infertility. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Effectiveness of the Combined Recombinant Human Growth Hormone and Gonadotropin-Releasing Hormone Analog Therapy in Pubertal Patients with Short Stature due to SHOX Deficiency

Context: Isolated heterozygous SHOX defects are the most frequent monogenic cause of short stature, and combined therapy with recombinant human GH (rhGH) and GnRH analog (GnRHa) in pubertal patients has been suggested, but there are no data on final height. Objective: The aim of the study was to analyze adult height after rhGH and GnRHa therapy in patients with SHOX haploinsufficiency. Patients: Ten peripubertal patients with isolated SHOX defects participated in the study. Intervention: Five patients were followed without treatment, and five were treated with rhGH (50 mu g/kg/d) and depot leuprolide acetate (3.75 mg/month). Main Outcome Measures: Adult height SD score (SDS) was measured. Results: All patients followed without treatment had marked downward growth shift during puberty (height SDS, -1.2 +/- 0.7 at 11.4 +/- 1.4 yr; adult height SDS, -2.5 +/- 0.5). Conversely, four of five patients treated with rhGH for 2 to 4.9 yr associated to GnRHa for 1.4 to 5.8 yr improved their height SDS from -2.3 +/- 1.3 at 11.8 +/- 2.1 yr to a final height SDS of -1.7 +/- 1.6. The difference between the mean height SDS at the first evaluation and final height SDS was statistically significant in nontreated vs. treated patients (mean height SDS change, -1.2 +/- 0.4 vs. 0.6 +/- 0.4, respectively; P < 0.001). Conclusion: A gain in adult height of patients with isolated SHOX defects treated with combined rhGH and GnRHa therapy was demonstrated for the first time, supporting this treatment for children with SHOX defects who have just started puberty to avoid the loss of growth potential observed in these patients during puberty. (J Clin Endocrinol Metab 95: 328-332, 2010)

Mannose-binding lectin gene polymorphism and resistance to therapy in women with recurrent vulvovaginal candidiasis

Precis Women with recurrent vulvovaginal candidiasis (RVC) due to a polymorphism in codon 54 of the MBL2 gene respond better to fluconazole maintenance therapy than do women with other underlying causes. Objective To explain differences in response rates to maintenance therapy with fluconazole in women suffering from RVC by evaluating associations with a polymorphism in the gene coding for mannose-binding lectin (MBL). Design Follow-up study, neted case-control group. Setting Women attending vulvoginitis clinic for RVC. Population Women participating in a multicentric study in Belgium with a degressive dose of fluconazole for RVC (the ReCiDiF trial) were divided into good responders, intermediate responders and nonresponders according to the number of relapses they experienced during therapy. From 109 of these women with adequate follow-up data, vaginal lavage with 2 ml of saline were performed at the moment of a proven acute attack at inclusion in the study, before maintenance treatment was started. A buccal swab was obtained from 55 age-matched women without a history of Candida infections, serving as a control group. Methods Extracted DNA from buccal or vaginal cells was tested for codon 54 MBL2 gene polymorphism by polymerase chain reaction and endonuclease digestion. Main outcome measures Frequency of MBL2 condon 54 allele B in women with optimal or poor response to maintenance therapy in composition with controls. Results Women (n = 109) suffering from RVC were more likely to carry the variant MBL2 codon 54 allele B than control women (20 versus 6.6%, OR 3.4 [95% CI 1.3-8.2], P = 0.01). B alleles were present in 25% of the 36 women not suffering from any recurrence during the maintenance therapy with decreasing doses of fluconazole (OR 4.9 [95% CI 1.9-12.5], P = 0.0007 versus controls), in 20% of the 43 women with sporadic recurrences (OR 3.6 [95% CI 1.4-9.2], P = 0.007 versus controls) and in 15% of the 30 women who had to interrupt the treatment regimen due to frequent relapses (P = 0.097 versus controls). Conclusions The MBL2 codon 54 gene polymorphism is more frequent in Belgian women suffering from RVC than in controls. The presence of the B allele is associated with a superior response to fluconazole maintenance therapy as compared with RVC patients without this polymorphism. We conclude that RVC due to deficient MBL production is more easily helped with antifungal medication than is RVC due to some other mechanism.

Viral Load Predicts New World Health Organization Stage 3 and 4 Events in HIV-Infected Children Receiving Highly Active Antiretroviral Therapy, Independent of CD4 T Lymphocyte Value

Background. Many resource-limited countries rely on clinical and immunological monitoring without routine virological monitoring for human immunodeficiency virus (HIV)-infected children receiving highly active antiretroviral therapy (HAART). We assessed whether HIV load had independent predictive value in the presence of immunological and clinical data for the occurrence of new World Health Organization (WHO) stage 3 or 4 events (hereafter, WHO events) among HIV-infected children receiving HAART in Latin America. Methods. The NISDI (Eunice Kennedy Shriver National Institute of Child Health and Human Development International Site Development Initiative) Pediatric Protocol is an observational cohort study designed to describe HIV-related outcomes among infected children. Eligibility criteria for this analysis included perinatal infection, age ! 15 years, and continuous HAART for >= 6 months. Cox proportional hazards modeling was used to assess time to new WHO events as a function of immunological status, viral load, hemoglobin level, and potential confounding variables; laboratory tests repeated during the study were treated as time-varying predictors. Results. The mean duration of follow-up was 2.5 years; new WHO events occurred in 92 (15.8%) of 584 children. In proportional hazards modeling, most recent viral load 15000 copies/mL was associated with a nearly doubled risk of developing a WHO event (adjusted hazard ratio, 1.81; 95% confidence interval, 1.05-3.11; P = 033), even after adjustment for immunological status defined on the basis of CD4 T lymphocyte value, hemoglobin level, age, and body mass index. Conclusions. Routine virological monitoring using the WHO virological failure threshold of 5000 copies/mL adds independent predictive value to immunological and clinical assessments for identification of children receiving HAART who are at risk for significant HIV-related illness. To provide optimal care, periodic virological monitoring should be considered for all settings that provide HAART to children.

Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

ERCC1 protein, mRNA expression and T19007C polymorphism as prognostic markers in head and neck squamous cell carcinoma patients treated with surgery and adjuvant cisplatin-based chemoradiation

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evaluation of the poly-L-lactic acid implant for treatment of the nasolabial fold: 3-year follow-up evaluation

The search for an ideal filler for soft tissue augmentation still continues. Because aging changes are continuous, temporary fillers should be preferred against permanent ones. Since 1999, the poly-L-lactic acid filler (PLA) has been marketed in Europe as Newfill. As a synthetic biocompatible polymer, PLA originally was used in suture materials and screws. In 2004, the U.S. Food and Drug Administration approved PLA under the name of Sculptra for the treatment of human immunodeficiency virus-related facial lipoatrophy. This study aimed to evaluate a 3-year follow-up investigation into the effect of PLA implant injection for the treatment of sunken nasolabial folds. Between October 2003 and February 2004, 10 women with a median age of 54 years (range, 43-60 years) were injected with polylactic acid hydrogel (Newfill) in the nasolabial fold area for aesthetic reasons. All the patients underwent three injections: one injection per month for 3 months. Evaluation of the results based on clinical examination and photography was performed at each session, at 6 months, and then 36 months after the third session. Injectable PLA was able to correct nasolabial folds successfully with a more lasting result than absorbable fillers commonly used in clinical practice, such as hyaluronic acid and collagen. Careful and standardized photographic documentation is indispensable.

Serum from children with polyarticular juvenile idiopathic arthritis (pJIA) inhibits differentiation, mineralization and may increase apoptosis of human osteoblasts ""in vitro""

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.

The-2518 bp promoter polymorphism at CCL2/MCP1 influences susceptibility to mucosal but not localized cutaneous leishmaniasis in Brazil

Mucosal leishmaniasis (ML) follows localized cutaneous leishmaniasis (CL) caused by Leishmania braziliensis. Proinflammatory responses mediate CL self-healing but are exaggerated in ML Proinflammatory monocyte chemoattractant protein 1 (MCP-1; encoded by CCL2) is associated with CL We explore its role in CL/ML through analysis of the regulatory CCL2 -2518 bp promoter polymorphism in CL/ML population samples and families from Brazil. Genotype frequencies were compared among ML/CL cases and control groups using logistic regression and the family-based association test (FBAT). MCP-1 was measured in plasma and macrophages. The GG recessive genotype at CCL2 -2518 bp was more common in patients with ML (N = 67) than in neighborhood control (NC; N = 60) subjects (OR 1.78; 95% Cl 1.01-3.14; P = 0.045), than in NC combined with leishmanin skin-test positive (N = 60) controls (OR 4.40; 95% CI 1.42-13.65; P = 0.010), and than in controls combined with CL (N = 60) patients (OR 2.78; 95% CI 1.13-6.85; P = 0.045). No associations were observed for CL compared to any groups. FBAT (91 ML and 223 CL cases in families) confirmed recessive association of ML with allele G (Z = 2.679; P = 0.007). Higher levels of MCP-1 occurred in plasma (P = 0.03) and macrophages (P < 0.0001) from GG compared to AA individuals. These results suggest that high MCP-1 increases risk of ML (C) 2010 Elsevier B.V. All rights reserved.

Peripheral blood chimerism following human liver transplantation

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Construction of a 1-Mb restriction-mapped cosmid contig containing the candidate region for the familial mediterranean fever locus (MEFV) on chromosome 16p13.3

In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAG, and YAC clones, we have generated a contig of genomic clones spanning similar to 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAG, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the similar to 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene. (C) 1997 Academic Press.

Platelet protease-activated receptor 1 and membrane expression of P-selectin in pulmonary arterial hypertension

Introduction: Pulmonary arterial hypertension (PAH) is frequently associated with thrombotic events, particularly involving the pulmonary microcirculation at sites of vascular injury. We therefore decided to analyse protease-activated receptor 1 (PAR1), a key element in the activation of human platelets by thrombin, in PAH patients in stable clinical condition. Methods: Using flow cytometry, we analyzed platelet PAR1 density, PAR1-mediated exposure of P-selectin and the formation of platelet-leukocyte aggregates in 30 PAH patients aged 11 to 78 years (median 50.5 years). The control group consisted of 25 healthy subjects with the same age range as patients. Results: In patients, total platelet PAR1 density and uncleaved PAR1 density correlated negatively with platelet count (r(2) = 0.33 and r(2) = 0.34 respectively, p < 0.0015). In patients with a low platelet count (<150 x 10(9) platelets/L), both densities were increased relative to controls (82% and 33% respectively, p < 0.05). Thrombin peptide-induced platelet exposure of P-selectin was directly related to total and uncleaved PAR1 density (respectively, r(2) = 0.33 and r(2) = 0.29, p < 0.0025) and increased in subjects with low platelet count (46% versus those with normal platelet count, p < 0.05). Patients with low platelet count had decreased in vitro thrombin-induced formation of platelet-leukocyte aggregates (57% decrease versus controls, p < 0.05). Conclusions: There seems to be a subpopulation of PAH patients with increased propensity to thrombotic events as suggested by increased platelet PAR1 expression and PAR-mediated surface exposure of P-selectin associated with decreased platelet count. (C) 2009 Elsevier Ltd. All rights reserved.