Cloning, characterization and regulation of the soluble guanylyl cyclase alpha1 and beta1 genes

Cell signaling by nitric oxide (NO) through soluble guanylyl cyclase (sGC) and cGMP production regulates physiological responses such as smooth muscle relaxation, neurotransmission, and cell growth and differentiation. Although the NO receptor, sGC, has been studied extensively at the protein level, information on regulation of the sGC genes remains elusive. In order to understand the molecular mechanisms involved at the level of gene expression, cDNA and genomic fragments of the murine sGCα1 subunit gene were obtained through library screenings. Using the acquired clones, the sGCα 1 gene structure was determined following primer extension, 3 ′RACE and intron/exon boundary analyses. The basal activity of several 5′-flanking regions (putative promoter regions) for both the α1 and β1 sGC subunits were determined following their transfection into mouse N1E-115 neuroblastoma and rat RENE1Δ14 uterine epithelial cells using a luciferase reporter plasmid. Using the sGC sequences, real-time RT-PCR assays were designed to measure mRNA levels of the sGC α1 and β1 genes in rat, mouse and human. Subsequent studies found that uterine sGC mRNA and protein levels decreased rapidly in response to 17β-estradiol (estrogen) in an in vivo rat model. As early as 1 hour following treatment, mRNA levels of both sGC mRNAs decreased, and reached their lowest level of expression after 3 hours. This in vivo response was completely blocked by the pure estrogen receptor antagonist, ICI 182,780, was not seen in several other tissues examined, did not occur in response to other steroid hormones, and was due to a post-transcriptional mechanism. Additional studies ex vivo and in various cell culture models suggested that the estrogen-mediated decreased sGC mRNA expression did not require signals from other tissues, but may require cell communication or paracrine factors between different cell types within the uterus. Using chemical inhibitors and molecular targeting in other related studies, it was revealed that c-Jun-N-terminal kinase (JNK) signaling was responsible for decreased sGC mRNA expression in rat PC12 and RFL-6 cells, two models previously determined to exhibit rapid decreased sGC mRNA expression in response to different stimuli. To further investigate the post-transcriptional gene regulation, the full length sGCα1 3′-untranslated region (3′UTR) was cloned from rat uterine tissue and ligated downstream of the rabbit β-globin gene and expressed as a chimeric mRNA in the rat PC12 and RFL-6 cell models. Expression studies with the chimeric mRNA showed that the sGCα 1 3′UTR was not sufficient to mediate the post-transcriptional regulation of its mRNA by JNK or cAMP signaling in PC12 and RFL-6 cells. This study has provided numerous valuable tools for future studies involving the molecular regulation of the sGC genes. Importantly, the present results identified a novel paradigm and a previously unknown signaling pathway for sGC mRNA regulation that could potentially be exploited to treat diseases such as uterine cancers, neuronal disorders, hypertension or various inflammatory conditions. ^

Tp53-dependent repression of cell cycle target genes: Global and mechanistic analysis

Most studies of p53 function have focused on genes transactivated by p53. It is less widely appreciated that p53 can repress target genes to affect a particular cellular response. There is evidence that repression is important for p53-induced apoptosis and cell cycle arrest. It is less clear if repression is important for other p53 functions. A comprehensive knowledge of the genes repressed by p53 and the cellular processes they affect is currently lacking. We used an expression profiling strategy to identify p53-responsive genes following adenoviral p53 gene transfer (Ad-p53) in PC3 prostate cancer cells. A total of 111 genes represented on the Affymetrix U133A microarray were repressed more than two fold (p ≤ 0.05) by p53. An objective assessment of array data quality was carried out using RT-PCR of 20 randomly selected genes. We estimate a confirmation rate of >95.5% for the complete data set. Functional over-representation analysis was used to identify cellular processes potentially affected by p53-mediated repression. Cell cycle regulatory genes exhibited significant enrichment (p ≤ 5E-28) within the repressed targets. Several of these genes are repressed in a p53-dependent manner following DNA damage, but preceding cell cycle arrest. These findings identify novel p53-repressed targets and indicate that p53-induced cell cycle arrest is a function of not only the transactivation of cell cycle inhibitors (e.g., p21), but also the repression of targets that act at each phase of the cell cycle. The mechanism of repression of this set of p53 targets was investigated. Most of the repressed genes identified here do not harbor consensus p53 DNA binding sites but do contain binding sites for E2F transcription factors. We demonstrate a role for E2F/RB repressor complexes in our system. Importantly, p53 is found at the promoter of CDC25A. CDC25A protein is rapidly degraded in response to DNA damage. Our group has demonstrated for the first time that CDC25A is also repressed at the transcript level by p53. This work has important implications for understanding the DNA damage cell cycle checkpoint response and the link between E2F/RB complexes and p53 in the repression of target genes. ^

Identification and characterization of new genes involved in Drosophila heart development

Heart development is a crucial and conserved process that is related to the major type of human birth defects. Dorsal vessel, the Drosophila heart, has been regarded as an insightful system to identify new genes and study gene functions involved in heart development. Using heart-specific GFP transgenes, I did a genetic screen for cardiogenic genes on Drosophila chromosome II. Drosophila mutants that carry chromosome II deficiencies were tested for their phenotypes of heart development. Based on the screen results, chromosome regions containing genes required for heart development were identified. Fly strains with single gene mutations located within the defined deficiency regions were tested further. Seven genes have been identified to be involved in heart development. ^ The LIM homeodomain transcription factor gene tailup (tup) was further studied for its function in heart development. Based on this study, tup is expressed in cardioblasts and pericardial cells of the heart tube, as well as in associated lymph glands and alary muscles. In depth analysis of tup mutant phenotypes demonstrated tup is required for normal development of both heart and lymph glands. Tup was shown to bind to two DNA recognition sequences in the dorsal vessel enhancer of the Hand bHLH transcription factor gene, with one site proven essential for the expression of Hand in lymph glands, pericardial cells, and Svp/Doc cardioblasts. Together, these studies demonstrate that Tup is a critical new transcription factor in dorsal vessel morphogenesis and lymph gland formation, and strongly suggest Tup is a direct regulator of the expression of Hand in these developmental processes. ^

Cis-acting elements and developmental regulators govern toxin gene expression in Bacillus anthracis

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

Identification of essential apoptotic genes in Drosophila

Apoptosis is a normal physiological cell suicide process which is essential for tissue homeostasis and normal development of metazoans. Misregulation of apoptosis is associated with many developmental defects and human diseases. The genes involved in the regulation and execution of apoptosis are highly conserved in humans and flies. Caspases are the executioners of cell suicide. Because of the unavailability of specific fly mutants, the developmental function of many caspase genes and genetic relationship between caspases and apoptotic components were undefined in Drosophila. We isolated several mutant alleles of the initiator caspase gene dronc, the effector casase drICE, and the Mediator component Cyclin C from the GMR-hid eyFLP/FRT screens which is designed to isolate mutants of recessive cell death genes in Drosophila melanogaster. Characterization of these mutants defined that they are essential for developmental cell death in Drosophila. dronc is required for most, but not all, cell death in Drosophila. drICE is required for apoptosis in many cells and it shares redundancy with another effector caspase gene, dcp-1, in a subset of cells in Drosophila. The genetic relationship between caspases and other apoptotic components was established through mutant analysis. We found that the pro-apoptotic protein Hid induces transcription of the initiator caspase gene dronc and the GMR-induced dronc transcripts are dependent on activated effector casapses, revealing a novel regulatory mechanism to promote caspase activity in Drosophila. Cyclin C and its kinase partner Cdk8 are required for prompt transcriptional induction of dronc in cell killing contexts. In short, we define the essential pro-apoptoic function of dronc, drICE, and Cyclin C in Drosophila and reveal a novel mechanism for regulation of dronc transcription. In the long run, these studies will help us decipher the complicated regulatory mechanism of cell death in humans. ^

Studies of the expression of DNA repair related genes

This dissertation examines the biological functions and the regulation of expression of DNA ligase I by studying its expression under different conditions.^ The gene expression of DNA ligase I was induced two- to four-fold in S-phase lymphoblastoid cells but was decreased to 15% of control after administration of a DNA damaging agent, 4-nitroquinoline-1-oxide. When cells were induced into differentiation, the expression level of DNA ligase I was decreased to less than 15% of that of the control cells. When the gene of DNA ligase I was examined for tissue specific expression in adult rats, high levels of DNA ligase I mRNA were observed in testis (8-fold), intermediate levels in ovary and brain (4-fold), and low levels were found in intestine, spleen, and liver (1- to 2-fold).^ In confluent cells of normal skin fibroblasts, UV irradiation induced the gene expression of DNA ligase I at 24 and 48 h. The induction of DNA ligase I gene expression requires active p53 protein. Introducing a vector containing the wild type p53 protein in the cells caused an induction of the DNA ligase I protein 24 h after the treatment.^ Our results indicate that, in addition to the regulation by phosphorylation/dephosphorylation, cellular DNA ligase I activity can be regulated at the gene transcription level, and the p53 tumor suppresser is one of the transcription factors for the DNA ligase I gene. Also, our results suggest that DNA ligase I is involved in DNA repair as well as in DNA replication.^ Also, as an early attempt to clone the human homolog of the yeast CDC9 gene which has been shown to be involved in DNA replication, DNA repair, and DNA recombination, we have identified a human gene with mRNA of 1.7 kb. This dissertation studies the gene regulation and the possible biological functions of this new human gene by examining its expression at different stages of the cell cycle, during cell differentiation, and in cellular response to DNA damage.^ The new gene that we recently identified from human cells is highly expressed in brain and reproductive organs (BRE). This BRE gene encodes an mRNA of 1.7-1.9 kb, with an open reading frame of 1,149 bp, and gives rise to a deduced polypeptide of 383 amino acid residues. No extensive homology was found between BRE and sequences from the EMBL-Gene Banks. BRE showed tissue-specific expression in adult rats. The steady state mRNA levels were high in testis (5-6 fold), ovary and brain (3-4 fold) compared to the spleen level, but low in intestine and liver (1-2 fold). The expression of this gene is responsive to DNA damage and/or retinoic acid (RA) treatment. Treatment of fibroblast cells with UV irradiation and 4-nitroquinoline-1-oxide caused more than 90% and 50% decreases in BRE mRNA, respectively. Similar decreases in BRE expression were observed after treatment of the brain glioma cell line U-251 and the promyelocytic cell line HL-60 with retinoic acid. (Abstract shortened by UMI). ^

HUMAN ENDOGENOUS RETROVIRUS K AS A NOVEL TUMOR-ASSOCIATED ANTIGEN FOR DEVELOPMENT OF AN OVARIAN CANCER VACCINE

HUMAN ENDOGENOUS RETROVIRUS K AS A NOVEL TUMOR-ASSOCIATED ANTIGEN FOR DEVELOPMENT OF AN OVARIAN CANCER VACCINE Publication No.________Kiera Rycaj, B.S.Supervisory Professor: Feng Wang-Johanning, Ph.D., M.D. Ovarian cancer (OC) is the fourth most common cancer in women, and the most lethal gynecologic malignancy in the United States. Adequate screening methodologies are currently lacking and most women first present with either stage III or IV disease. To date, there has been no substantial decrease in death rates and the majorities of patients relapse and die from their disease despite response to first-line therapy. Several proteins, such as CA-125, are elevated in OC, but none has proven specific and sensitive enough to serve as a screening tool or for tumor cell recognition and lysis. It has been proposed that human endogenous retrovirus sequences (HERVs) may play a role in the etiology of certain cancers. In a previous study, we showed that HERV-K envelope (env) proteins are widely expressed in human invasive breast cancer (BC) and ductal carcinoma in situ (DCIS), and elicit both serologic and cell-mediated immune responses in BC patients. We also reported the expression of multiple HERV genes and proteins in OC cell lines and tissues. In this study, we strengthened our previous data by determining that HERV-K env mRNAs are expressed in 69% of primary OC tissues (n=29), but in only 24% of benign tissues (N=17). Immmunohistochemistry (IHC) staining revealed HERV-Kpositivecancer cells detected in endometrioid adenocarcinoma and serous adenocarcinoma but not in benign cyst or normal epithelium biopsies. Immunofluorescence staining (IFS) showed greater cell surface expression of HERV-K in OC samples compared to adjacent uninvolved samples. Enzyme-linked immunosorbent assay (ELISA) data confirmed that a humoral immune response is elicited against HERV-K in OC patients. T-cell responses against HERV-K in lymphocytes from OC patients stimulated with autologous HERV-K pulsed dendritic cells included induction of T-cell proliferation and IFN-γ production. HERV-K–specific cytolytic T cells induced greater specific lysis of OC target cells compared to benign and adjacent uninvolved target cells. Finally, upon T regulatory cell (T-reg) depletion, 64% of OC patients displayed an increase in the specific lysis of target cells expressing HERV-K env protein. These findings suggest that HERV-K env protein is a tumor-associated antigen capable of activating both T-cell and B-cell responses in OC patients, and has great potential in the development of immunotherapy regimens against OC.

Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Minimal DNA sequences that control the cell lineage-specific expression of the pro$\alpha$2(I) collagen promoter in transgenic mice

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Molecular and evolutionary genetics of the X -linked visual pigment genes in humans and New World monkeys

Normal humans have one red and at least one green visual pigment genes. These genes are tightly linked as tandem repeats on the X chromosome and each of them has six exons. There is only one X-linked visual pigment gene in New World monkeys (NWMs) but the locus has three polymorphic alleles encoding red, yellow and green visual pigments, respectively. The spectral properties of the squirrel monkey and the marmoset (both NWMs) have been studied and partial sequences of the three alleles are available. To study the evolutionary history of these X-linked opsin genes in humans and NWMs, coding and intron sequences of the three squirrel monkey alleles and the three marmoset alleles were amplified by PCR followed by subcloning and sequencing. Introns 2 and 4 of the human red and green pigment genes were also sequenced. The results obtained are as follows: (1) The sequences of introns 2 and 4 of the human red and green opsin genes are significantly more similar between the two genes than are coding sequences, contrary to the usual situation where coding regions are better conserved in evolution than are introns. The high similarities in the two introns are probably due to recent gene conversion events during evolution of the human lineage. (2) Phylogenetic analysis of both intron and exon sequences indicates that the phylogenetic tree of the available primate opsin genes is the same as the species tree. The two human genes were derived from a gene duplication event after the divergence of the human and NWM lineages. The three alleles in each of the two NWM species diverged after the split of the two NWMs but have persisted in the population for at least 5 million years. (3) Allelic gene conversion might have occurred between the three squirrel monkey alleles. (4) A model of additive effect of hydroxyl-bearing amino acids on spectral tuning is proposed by treating some unknown variables as groups. Under the assumption that some residues have no effect, it is found that at least five amino acid residues, at positions 178 (3 nm), 180 (5 nm), 230 ($-$4 nm), 277 (9 nm) and 285 (13 nm), have linear spectral tuning effects. (5) Adaptive evolution of the opsin genes to different spectral peaks was observed at four residues that are important for spectral tuning. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Molecular and genetic analysis of Myxococcus xanthus early *development

To identify more mutations that can affect the early development of Myxococcus xanthus, the synthetic transposon TnT41 was designed and constructed. By virtue of its special features, it can greatly facilitate the processes of mutation screening/selection, mapping, cloning and DNA sequencing. In addition, it allows for the systematic discovery of genes in regulatory hierarchies using their target promoters. In this study, the minimal regulatory region of the early developmentally regulated gene 4521 was used as a reporter in the TnT41 mutagenesis. Both positive (P) mutations and negative (N) mutations were isolated based on their effects on 4521 expression.^ Four of these mutations, i.e. N1, N2, P52 and P54 were analyzed in detail. Mutations N1 and N2 are insertion mutations in a gene designated sasB. The sasB gene is also identified in this study by genetic and molecular analysis of five UV-generated 4521 suppressor mutations. The sasB gene encodes a protein without meaningful homology in the databases. The sasB gene negatively regulates 4521 expression possibly through the SasS-SasR two component system. A wild-type sasB gene is required for normal M. xanthus fruiting body formation and sporulation.^ Cloning and sequencing analysis of the P52 mutation led to the identification of an operon that encodes the M. xanthus high-affinity branched-chain amino acid transporter system. This liv operon consists of five genes designated livK, livH, livM, livC, and livF, respectively. The Liv proteins are highly similar to their counterparts from other bacteria in both amino acid sequences, functional motifs and predicted secondary structures. This system is required for development since liv null mutations cause abnormality in fruiting body formation and a 100-fold decrease in sporulation efficiency.^ Mutation P54 is a TnT41 insertion in the sscM gene of the ssc chemotaxis system, which has been independently identified by Dr. Shi's lab. The sscM gene encodes a MCP (methyl-accepting chemotaxis protein) homologue. The SscM protein is predicted to contain two transmembrane domains, a signaling domain and at least one putative methylation site. Null mutations of this gene abolish the aggregation of starving cells at a very early stage, though the sporulation levels of the mutant can reach 10% that of wild-type cells. ^

A novel DNA damage inducible inhibitor of p53

p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^