Simulador radiográfico antropomórfico de mama humana

Mammography is a diagnostic imaging method in which interpretation depends on knowledge of radiological aspects as well as the clinical exam and pathophysiology of breast diseases. In this work a mammography phantom was developed to be used for training in the operation of mammographic x-ray equipment, image quality evaluation, self-examination and clinical examination of palpation. Polyurethane was used for the production of the phantoms for its physical and chemical properties and because it is one of the components normally used in prostheses. According to the range of flexibility of the polyurethane, it was possible to simulate breasts with higher or lower amount of adipose tissue. Pathologies such as areolar necrosis and tissue rejection due to surgery reconstruction after partial mastectomy were also simulated. Calcifications and nodules were simulated using the following materials: polyethylene, poly (methyl methacrylate), polyamide, polyurethane and poly (dimethyl silicone). Among these, polyethylene was able to simulate characteristics of calcification as well as breast nodules. The results from mammographic techniques used in this paper for the evaluation of the phantoms are in agreement with data found in the literature. The image analyses of four phantoms indicated significant similarities with the human skin texture and the female breast parenchyma. It was possible to detect in the radiographic images produced regions of high and low radiographic optical density, which are characteristic of breasts with regions of different amount of adipose tissue. The stiffnesses of breast phantoms were adjusted according to the formulation of the polyurethane which enabled the production of phantoms with distinct radiographic features and texture similar to human female breast parenchyma. Clinical palpation exam of the phantoms developed in this work indicated characteristics similar to human breast in skin texture, areolar region and parenchyma

Síntese hidrotérmica assistida por micro-ondas de tiO2, e aplicação em nanocompósito

In recent decades have seen a sharp growth in the study area of nanoscience and nanotechnology and is included in this area, the study of nanocomposites with self-cleaning properties. Since titanium dioxide (TiO2) has high photocatalytic activity and also antimicrobial, self-cleaning surfaces in your application has been explored. In this study a comparison was made between two synthesis routes to obtain TiO2 nanoparticles by hydrothermal method assisted by microwave. And after analysis of XRD and SEM was considered the best material for use in nanocomposites. It was deposited nanocomposite film of poly (dimethyl siloxane) (PDMS) with 0.5, 1, 1.5 and 2% by weight of nanoparticles of titanium dioxide (TiO2) by the spraying method. The nanocomposite was diluted with hexane and the suspension was deposited onto glass substrate, followed by curing in an oven with forced air circulation. The photocatalytic activity of the nanocomposite impregnated with methylene blue was evaluated by UV- vis spectroscopy from the intensity variation of absorption main peak at 660nm with time of exposure to the UV chamber. Changes in the contact angle and microhardness were analyzed before and after UV aging test. The effect of ultraviolet radiation on the chemical structure of the PDMS matrix was evaluated by spectrophotometry Fourier transform infrared (FTIR).The results indicated that the addition of TiO2 nanoparticles in the coating PDMS gave high photocatalytic activity in the decomposition of methylene blue, an important characteristic for the development of self-cleaning coatings

Avaliação da espécie vegetal Croton cajucara Benth como inibidor de biocorrosão em aço carbono Aisi 1020

Actually in the oil industry biotechnological approaches represent a challenge. In that, attention to metal structures affected by electrochemical corrosive processes, as well as by the interference of microorganisms (biocorrosion) which affect the kinetics of the environment / metal interface. Regarding to economical and environmental impacts reduction let to the use of natural products as an alternative to toxic synthetic inhibitors. This study aims the employment of green chemistry by evaluating the stem bark extracts (EHC, hydroalcoholic extract) and leaves (ECF, chloroform extract) of plant species Croton cajucara Benth as a corrosion inhibitor. In addition the effectiveness of corrosion inhibition of bioactive trans-clerodane dehydrocrotonin (DCTN) isolated from the stem bark of this Croton was also evaluated. For this purpose, carbon steel AISI 1020 was immersed in saline media (3,5 % NaCl) in the presence and absence of a microorganism recovered from a pipeline oil sample. Corrosion inhibition efficiency and its mechanisms were investigated by linear sweep voltammetry and electrochemical impedance. Culture-dependent and molecular biology techniques were used to characterize and identify bacterial species present in oil samples. The tested natural products EHC, ECF and DCTN (DMSO as solvent) in abiotic environment presented respectively, corrosion inhibition efficiencies of 57.6% (500 ppm), 86.1% (500 ppm) and 54.5% (62.5 ppm). Adsorption phenomena showed that EHC best fit Frumkin isotherm and ECF to Temkin isotherm. EHC extract (250 ppm) dissolved in a polar microemulsion system (MES-EHC) showed significant maximum inhibition efficiency (93.8%) fitting Langmuir isotherm. In the presence of the isolated Pseudomonas sp, EHC and ECF were able to form eco-compatible organic films with anti-corrosive properties

Avaliação da atividade antimalárica de extratos obtidos de algas marinhas no litoral do Rio Grande do Norte

Malaria is a major parasitic disease worldwide, accounting for about 500 million cases and causing 2 million to 3 million deaths annually. Four species are responsible for transmitting this disease to humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae and Plasmodium ovale. The parasite resistance to antimalarial drugs and the usual limitations of the vector control implications are contributing to the spread of the disease. The most of significant advances in the search for new antimalarial drugs is based on natural components, the main ones being currently used antimalarial drugs derived from plants. Research on natural products of marine origin (particularly algae) show that some species possess antiplasmodial activity. Knowing that the coast of Rio Grande do Norte is home to several species of algae, the present study was to evaluate, for the first time, the antimalarial activity of ethanolic extracts of seaweed Spatoglossum schroederi, Gracilaria birdiae and Udotea flabellum against Plasmodium falciparum 3D7 strain tests and in vitro using the murine model (Plasmodium berghei) for evaluation in vivo. These species were ground, macerated with ethanol for 24 hours and the extracts concentrated in rotaevaporador (45 ° C ± 5 ° C). For in vitro tests, the extracts were diluted and tested at concentrations between 100 and 1.56 μg/ml (seven concentrations in triplicate), in order to obtain IC50 of each extract. The cytotoxicity tests with macrophages and BGM were performed using the MTT colorimetric assay. BGM macrophages and cells were distributed in 96 wells per plate (1x 105 to macrophages and 1x104 cells per well for BGM) and incubated for 24h at 37 ° C. The ethanol extracts were diluted and tested at concentrations of 100 to 1,56 μg/ml (seven concentrations in triplicate). After periods of 24 hours of incubation with the extracts, 100 μg of MTT was added to each well, and 3 hours elapsed, the supernatant was removed and added 200 μl of DMSO in each well. The absorbance of each well was obtained by reading on a spectrophotometer at 570 nm filter. To evaluate the acute toxicity in vivo, Swiss mice received a single dose (oral) 2000 mg/kg/animal of each extract tested. The parameters of acute toxicity were observed for 8 days. For in vivo tests, Swiss mice were inoculated with 1x105 erythrocytes infected with P. berghei. The treatment was given first to fourth day after infection with 0.2 ml of the extracts in doses of 1000 and 500 mg//g animal. The negative control group received 0.2 ml of 2% Tween-20, whereas the positive control group received sub-dose of chloroquine (5 mg/kg/animal). The assessment of antimalarial activity was done by suppressing suppressing the parasitemia at 5 and 7 days after infection. The growth inhibition of parasites was determined relative to negative control (% inhibition = parasitaemia in control - parasitemia in sample / parasitemia control x 100), the mortality of animals was monitored daily for 30 days The results showed that algae Spatoglossum schroederi and Udotea flabellum showed antimalarial activity in vitro, with reduced parasitemia of 70.54% and 54, respectively. The extracts of the three algae tested showed moderate to high cytotoxicity. Algae S. schroederi and U. flabellum were active against P. berghei only at doses of 500 mg / kg with reduction ranging from 54.58 to 52.65% for the fifth day and from 32.24 to 47.34% for the seventh day, respectively. No toxicity was observed in vivo at the dose tested, over the 8 days of observation. Although preliminary data, the bioactive components in those possible seaweed may be promising for the development of new anti-malarial drugs

On the interaction of bovine serum albumin with ionic surfactants: Temperature induced EPR changes of a maleimide nitroxide reflect local protein dynamics and probe solvent accessibility

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Respostas de híbridos de milho ao nicosulfuron: I - aspectos biológlcos e da produção

Um ensaio de campo foi conduzido em 1994/95, na Fazenda de Ensino e Pesquisa da Faculdade de Ciências Agrárias e Veterinárias (UNESP) de Jaboticabal, SP, sendo os objetivos do trabalho comparar aspectos biológicos e produtivos de nove diferentes híbridos de milho, resultantes da aplicação da dose de 80 g.ha-1 de nicosulfuron {2- [[[[4,6-dimetoxi-2-pirimidina) amina] carboxil] amina] sulfonil] -N,N-dimetil-3-piridinacarboxiamida} em relação a plantas não tratadas. Verificou-se que o herbicida afetou significativamente alguns dos aspectos biológicos estudados (altura de plantas e de espigas, número de folhas, comprimento e largura de folhas e estande final) e não afetou os relacionados com a posição relativa das espigas, o diâmetro do colmo, as porcentagens de acamamento e de quebramento. A produtividade estimada dos híbridos tratados não foi afetada pela aplicação do produto, com exceção da estimada para o híbrido HT 2X.

Vitrification with DAP 213 and Cryotop of Ex Situ and In Situ Feline Cumulus-Oocyte Complexes

This study was undertaken to compare cryotolerance, in terms of viability and resumption of meiosis after warming and culture (24 and 48 h), of ex situ (isolated) and in situ (enclosed in the ovarian tissue) feline cumulusoocyte complexes (COCs) vitrified with DAP 213 (2 M DMSO, 1 M acetamide, 3 M propylene glycol) in cryotubes or Cryotop method. Ovaries were harvested from 49 pubertal queens. of each pair of ovaries, one was dissected to release COCs randomly divided into three groups: fresh COCs (control), ex situ COCs vitrified with DAP 213 and Cryotop. The cortex of the other ovary was sectioned into small fragments (approximately 1.5 mm3) and randomly assigned to be vitrified by DAP 213 or Cryotop. After warming, ex situ and in situ (retrieved form vitrified ovarian tissue) COCs were matured in vitro. Viability of oocytes was highly preserved after warming and culture in all treatments. Proportions of oocytes surrounded by complete layers of viable cumulus cells were remarkably decreased (p < 0.00001) in both vitrification procedures compared to fresh oocytes. Resumption of meiosis occurred in all treatments. After 24 h of culture, results were similar in ex situ and in situ vitrified oocytes regardless of the vitrification protocol used (range 29-40%), albeit lower (p < 0.05) than those of fresh oocytes (65.8%). After 48 h of culture, ex situ oocytes vitrified with Cryotop achieved the rates of meiosis resumption similar to fresh oocytes (53.8% vs 67.5%; p > 0.05) and ex situ and in situ oocytes vitrified with DAP 213 showed similar rates of resumption of meiosis. These findings demonstrated that DAP 213 and Cryotop preserve the viability of ex situ and in situ oocytes, but cumulus cells are highly susceptible to vitrification. However, the capability to resume meiosis evidences that feline immature oocytes vitrified as isolated or enclosed in the ovarian cortex have comparable cryotolerance.

Conservação e qualidade de mangas 'Palmer' submetidas a tratamento com fungicidas e hidrotérmico

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Interaction of small amounts of bovine serum albumin with phospholipid monolayers investigated by surface pressure and atomic force microscopy

The influence of small amounts of bovine serum albumin (BSA) (nM concentration) on the lateral organization of phospholipid monolayers at the air-water interface and transferred onto solid substrates as one-layer Langmuir-Blodgett (LB) films was investigated. The kinetics of adsorption of BSA onto the phospholipid monolayers was monitored with surface pressure isotherms in a Langmuir trough, for the zwitterionic dipalmitoylphosphatidyl ethanolamine (N,N-dimethyl-PE) and the anionic dimyristoylphosphatidic acid (DMPA). A monolayer of N,N-dimethyl-PE or DMPA incorporating BSA was transferred onto a solid substrate using the Langmuir-Blodgett technique. Atomic force microscopy (AFM) images of one-layer LB films displayed protein-phospholipid domains, whose morphology was characterized using dynamic scaling theories to calculate roughness exponents. For DMPA-BSA films the surface is characteristic of self-affine fractals, which may be described with the Kardar-Parisi-Zhang (KPZ) equation. on the other hand, for N,N-dimethyl-PE-BSA films, the results indicate a relatively flat surface within the globule. The height profile and the number and size of globules varied with the type of phospholipid. The overall results, from kinetics of adsorption on Langmuir monolayers and surface morphology in LB films, could be interpreted in terms of the higher affinity of BSA to the anionic DMPA than to the zwitterionic N,N-dimethyl-PE. Furthermore, the effects from such small amounts of BSA in the monolayer point to a cooperative response of DMPA and N,N-dimethyl-PE monolayers to the protein. (c) 2005 Elsevier B.V. All rights reserved.

New palladium(II) complexes with pyrazole ligands Part I. Synthesis, spectral and thermal studies, and antitumor evaluation

The pyrazole ligand 3,5-dimethyl-4-iodopyrazole (HdmIPz) has been used to obtain a series of palladium(II) complexes (1-4) of the type [PdX(2)(HdmIPz)(2)] {X = Cl(-) (1); Br(-) (2); I(-) (3); SCN(-) (4)}. All compounds have been isolated, purified, and characterized by means of elemental analysis, IR spectroscopy, (1)H and (13)C{(1)H}-NMR experiments, differential thermal analysis (DTA), and thermogravimetry (TG). The TG/DTA curves showed that the compounds released ligands in the temperature range 137-605 A degrees C, yielding metallic palladium as final residue. The complexes and the ligand together with cisplatin have been tested in vitro by MTT assay for their cytotoxicity against two murine cancer cell lines: mammary adenocarcinoma (LM3) and lung adenocarcinoma (LP07).

Ruthenium(II) phosphine/diimine/picolinate complexes: Inorganic compounds as agents against tuberculosis

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Evaluation of anti-Mycobacterium tuberculosis activity of Campomanesia adamantium (Myrtaceae)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anxiolytic-like effects of erythrinian alkaloids from erythrina suberosa

Two alkaloids, erysodine (1) and erysothrine (2) were isolated from the flowers of a Pakistani medicinal plant, Erythrina suberosa. These compounds were investigated for anxiolytic properties, and the results showed significant effect, in an acute oral treatment with 1-2, which were suspended in saline (NaCl 0.9%) plus DMSO 1%, and evaluated in 122 Swiss male mice exposed to two tests of anxiety - the elevated plus-maze (EPM) and the light/dark transition model (LDTM).

Semipreparative enantioseparation of methamidophos by HPLC-UV and preliminary in vitro study of butyrylcholinesterase inhibition

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)