999 resultados para Controle de qualidade em radioterapia


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The bond between steel and concrete is essential for the existence of reinforced concrete structures, as both materials act together to absorb structural strain. The bond phenomenon is considered to be complex regarding many factors that affect it. Several types of bond tests have been proposed over years. One is the modified proposed of pull-out test, which was elaborated by Lorrain and Barbosa [1] called APULOT test (Appropriete pull-out-test). Based on experimental results obtained by Vale Silva[2] either by conventional pull-out tests, or by modified pull-out test, APULOT, seeks to know the numeric behavior of bond steel-concrete through a numerical simulation using a calculation code ATENA which is based on the Finite Element Method (FEM). The numerical simulation provided better evaluate the stress distribution and cracking that occurs during the test, thereby becoming a valuable tool to support the experimental project that aims to validation, validation partially or not recommend the modified bond test steel-concrete - APULOT test - as quality control test of structural concrete. The numerical results showed good representation compared to experimental results.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The implementation of local geodetic networks for georeferencing of rural properties has become a requirement after publication of the Georeferencing Technical Standard by INCRA. According to this standard, the maximum distance of baselines to GNSS L1 receivers is of 20 km. Besides the length of the baseline, the geometry and the number of geodetic control stations are other factors to be considered in the implementation of geodetic networks. Thus, this research aimed to examine the influence of baseline lengths higher than the regulated limit of 20 km, the geometry and the number of control stations on quality of local geodetic networks for georeferencing, and also to demonstrate the importance of using specific tests to evaluate the solution of ambiguities and on the quality of the adjustment. The results indicated that the increasing number of control stations has improved the quality of the network, the geometry has not influenced on the quality and the baseline length has influenced on the quality; however, lengths higher than 20 km has not interrupted the implementation, with GPS L1 receiver, of the local geodetic network for the purpose of georeferencing. Also, the use of different statistical tests, both for the evaluation of the resolution of ambiguities and for the adjustment, have enabled greater clearness in analyzing the results, which allow that unsuitable observations may be eliminated.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The use of medicinal plants corresponds to an ancient practice, either as an alternative medicine for the cure of several diseases, or as a method of abortion. Nevertheless, the population in general does not know the risks involved in the use of medicinal plants. In this sense, the purpose of the study was to evaluate the consumption rate of medicinal plants by women in a Basic Health Unit (BHU), on order to identify which plant species have been most frequently consumed by them, including during the pregnancy. Through an exploratory questionnaire with 48 women, it was observed that most part of the interviewees had children and the most of them cited Peumus boldus, Baccharis trimera and Cassia angustifolia, which were mainly used for stomach aches or digestives (53%), for colds (23%), menstrual cramps (4%) or to menstruate (2%). The remaining part of the study consisted in the visual and chemical analysis of the plant species cited by the interviewees, including other species that have been popularly used as a method of abortion. Comparative visual analysis of medicinal plants (Group A-C) from four different shops showed the absence of quality control concerning packing specifications and the separation of the plant material to be consumed. The analysis of the chemical profiles of these samples by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) indicated that those species belonging to the Group C were significantly different from those plants having the same identification, except for Peumus boldus, whose samples were similar in terms of chemical composition.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The goal of this paper is to present a methodology for quality control of horizontal geodetic networks through robustness and covariance analysis. In the proposed methodology, the positional accuracy of each point is estimated by a possible bias in their position (based on robustness analysis), in addition to its own positional precision (uncertainty) (through covariance analysis), being a measure independently from the choice of the datum. Besides presenting the theoretical development of the method, its application is demonstrated in a numerical example. The results indicate that, in general, the greater the distance of an unknown point to the control(s) point(s) of the network, the greater is the propagation of random errors on this unknown point, and the smaller the number of redundant observations around a unknown point, the greater the influence of possible (undetected) non-random errors on this point.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Pós-graduação em Engenharia Mecânica - FEG

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Pós-graduação em Genética e Melhoramento Animal - FCAV

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Pós-graduação em Química - IQ

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

80.00% 80.00%

Publicador:

Resumo:

There is a growing search for continuous improvement within the companies which creates an obligation of reducing and when it is possible eliminating waste. Production Planning and Control Department (PCP) is not out of this question, making necessary the application of methods and creation of tools that eliminate steps which do not add value to the planning process. This paper aims to develop a tool which concentrates in just one place all the necessary information to make the packaging material requirement planning (MRP) in a agribusiness company. Besides, it also aims, in a more visual way and using devices that prevent mistakes (Poka-Yoke), to reduce the number of reviews and mistakes made by analysts. As a result, an Excel spreadsheet was developed. This spreadsheet shows what happens with the status of planning and receiving of packaging, giving some advices when some critical situation happens. The use of Lean Manufacturing Method and the action research method helped to well define the problem and to reduce the number of steps, spreadsheets and time of process in 80%, 60% and 75%, respectively