Expression, production, and renaturation of a functional single-chain variable antibody fragment (scFv) against human ICAM-1

Intercellular adhesion molecule-1 (ICAM-1) is an important factor in the progression of inflammatory responses in vivo. To develop a new anti-inflammatory drug to block the biological activity of ICAM-1, we produced a monoclonal antibody (Ka=4.19×10−8 M) against human ICAM-1. The anti-ICAM-1 single-chain variable antibody fragment (scFv) was expressed at a high level as inclusion bodies in Escherichia coli. We refolded the scFv (Ka=2.35×10−7 M) by ion-exchange chromatography, dialysis, and dilution. The results showed that column chromatography refolding by high-performance Q Sepharose had remarkable advantages over conventional dilution and dialysis methods. Furthermore, the anti-ICAM-1 scFv yield of about 60 mg/L was higher with this method. The purity of the final product was greater than 90%, as shown by denaturing gel electrophoresis. Enzyme-linked immunosorbent assay, cell culture, and animal experiments were used to assess the immunological properties and biological activities of the renatured scFv.

Changes in cardiac aldosterone and its synthase in rats with chronic heart failure: an intervention study of long-term treatment with recombinant human brain natriuretic peptide

The physiological mechanisms involved in isoproterenol (ISO)-induced chronic heart failure (CHF) are not fully understood. In this study, we investigated local changes in cardiac aldosterone and its synthase in rats with ISO-induced CHF, and evaluated the effects of treatment with recombinant human brain natriuretic peptide (rhBNP). Sprague-Dawley rats were divided into 4 different groups. Fifty rats received subcutaneous ISO injections to induce CHF and the control group (n=10) received equal volumes of saline. After establishing the rat model, 9 CHF rats received no further treatment, rats in the low-dose group (n=8) received 22.5 μg/kg rhBNP and those in the high-dose group (n=8) received 45 μg/kg rhBNP daily for 1 month. Cardiac function was assessed by echocardiographic and hemodynamic analysis. Collagen volume fraction (CVF) was determined. Plasma and myocardial aldosterone concentrations were determined using radioimmunoassay. Myocardial aldosterone synthase (CYP11B2) was detected by quantitative real-time PCR. Cardiac function was significantly lower in the CHF group than in the control group (P<0.01), whereas CVF, plasma and myocardial aldosterone, and CYP11B2 transcription were significantly higher than in the control group (P<0.05). Low and high doses of rhBNP significantly improved hemodynamics (P<0.01) and cardiac function (P<0.05) and reduced CVF, plasma and myocardial aldosterone, and CYP11B2 transcription (P<0.05). There were no significant differences between the rhBNP dose groups (P>0.05). Elevated cardiac aldosterone and upregulation of aldosterone synthase expression were detected in rats with ISO-induced CHF. Administration of rhBNP improved hemodynamics and ventricular remodeling and reduced myocardial fibrosis, possibly by downregulating CYP11B2 transcription and reducing myocardial aldosterone synthesis.

Bone marrow mesenchymal stem cells overexpressing human basic fibroblast growth factor increase vasculogenesis in ischemic rats

Administration or expression of growth factors, as well as implantation of autologous bone marrow cells, promote in vivo angiogenesis. This study investigated the angiogenic potential of combining both approaches through the allogenic transplantation of bone marrow-derived mesenchymal stem cells (MSCs) expressing human basic fibroblast growth factor (hbFGF). After establishing a hind limb ischemia model in Sprague Dawley rats, the animals were randomly divided into four treatment groups: MSCs expressing green fluorescent protein (GFP-MSC), MSCs expressing hbFGF (hbFGF-MSC), MSC controls, and phosphate-buffered saline (PBS) controls. After 2 weeks, MSC survival and differentiation, hbFGF and vascular endothelial growth factor (VEGF) expression, and microvessel density of ischemic muscles were determined. Stable hbFGF expression was observed in the hbFGF-MSC group after 2 weeks. More hbFGF-MSCs than GFP-MSCs survived and differentiated into vascular endothelial cells (P<0.001); however, their differentiation rates were similar. Moreover, allogenic transplantation of hbFGF-MSCs increased VEGF expression (P=0.008) and microvessel density (P<0.001). Transplantation of hbFGF-expressing MSCs promoted angiogenesis in an in vivo hind limb ischemia model by increasing the survival of transplanted cells that subsequently differentiated into vascular endothelial cells. This study showed the therapeutic potential of combining cell-based therapy with gene therapy to treat ischemic disease.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effect of estradiol and bisphenol A on human hepatoblastoma cell viability and telomerase activity

Sex hormones from environmental and physiological sources might play a major role in the pathogenesis of hepatoblastoma in children. This study investigated the effects of estradiol and bisphenol A on the proliferation and telomerase activity of human hepatoblastoma HepG2 cells. The cells were divided into 6 treatment groups: control, bisphenol A, estradiol, anti-estrogen ICI 182,780 (hereinafter ICI), bisphenol A+ICI, and estradiol+ICI. Cell proliferation was measured based on average absorbance using the Cell Counting-8 assay. The cell cycle distribution and apoptotic index were determined by flow cytometry. Telomerase activity was detected by polymerase chain reaction and a telomeric repeat amplification protocol assay. A higher cell density was observed in bisphenol A (P<0.01) and estradiol (P<0.05) groups compared with the control group. Cell numbers in S and G2/M phases after treatment for 48 h were higher (P<0.05), while the apoptotic index was lower (P<0.05) and telomerase activities at 48 and 72 h (P<0.05) were higher in these groups than in the control group. The cell density was also higher in bisphenol A+ICI (P<0.01) and estradiol+ICI (P<0.05) groups compared with the ICI group. Furthermore, cell numbers were increased in S and G2/M phases (P<0.05), while the apoptotic index was lower (P<0.05) and telomerase activities at 48 and 72 h were higher (P<0.05) in these groups than in the ICI group. Therefore, bisphenol A and estradiol promote HepG2 cell proliferation in vitro by inhibition of apoptosis and stimulation of telomerase activity via an estrogen receptor-dependent pathway.

Effects of IL-10 and glucose on expression of OPG and RANKL in human periodontal ligament fibroblasts

The effects of interleukin-10 (IL-10) and glucose on mRNA and protein expression of osteoprotegerin (OPG), and its ligand, receptor activator of nuclear factor-κB ligand (RANKL), were investigated in human periodontal ligament fibroblasts (HPDLFs). Primary HPDLFs were treated with different concentrations of IL-10 (0, 1, 10, 25, 50, and 100 ng/mL) or glucose (0, 5.5, 10, 20, 30, and 40 mmol/L). Changes in mRNA and protein expression were examined using the reverse-transcription polymerase chain reaction (RT-PCR) and Western blot analysis, respectively. After IL-10 treatment, mRNA and protein levels of OPG were increased, while mRNA and protein levels of RANKL were decreased (P<0.05), both in a concentration-dependent manner. Glucose stimulation had the opposite concentration-dependent effect to that of IL-10 on OPG and RANKL expression. IL-10 upregulated OPG expression and downregulated RANKL expression, whereas high glucose upregulated RANKL and downregulated OPG in HDPLFs. Abnormal levels of IL-10 and glucose may contribute to the pathogenesis of periodontal disease.

Effect of microRNA-21 on the proliferation of human degenerated nucleus pulposus by targeting programmed cell death 4

This study aims to explore the effect of microRNA-21 (miR-21) on the proliferation of human degenerated nucleus pulposus (NP) by targeting programmed cell death 4 (PDCD4) tumor suppressor. NP tissues were collected from 20 intervertebral disc degeneration (IDD) patients, and from 5 patients with traumatic spine fracture. MiR-21 expressions were tested. NP cells from IDD patients were collected and divided into blank control group, negative control group (transfected with miR-21 negative sequences), miR-21 inhibitor group (transfected with miR-21 inhibitors), miR-21 mimics group (transfected with miR-21 mimics) and PDCD4 siRNA group (transfected with PDCD4 siRNAs). Cell growth was estimated by Cell Counting Kit-8; PDCD4, MMP-2,MMP-9 mRNA expressions were evaluated by qRT-PCR; PDCD4, c-Jun and p-c-Jun expressions were tested using western blot. In IDD patients, the expressions of miR-21 and PDCD4 mRNA were respectively elevated and decreased (both P<0.05). The miR-21 expressions were positively correlated with Pfirrmann grades, but negatively correlated with PDCD4 mRNA (both P<0.001). In miR-21 inhibitor group, cell growth, MMP-2 and MMP-9 mRNA expressions, and p-c-Jun protein expressions were significantly lower, while PDCD4 mRNA and protein expressions were higher than the other groups (all P<0.05). These expressions in the PDCD4 siRNA and miR-21 mimics groups was inverted compared to that in the miR-21 inhibitor group (all P<0.05). MiR-21 could promote the proliferation of human degenerated NP cells by targeting PDCD4, increasing phosphorylation of c-Jun protein, and activating AP-1-dependent transcription of MMPs, indicating that miR-21 may be a crucial biomarker in the pathogenesis of IDD.

Natural born weight gainers: The mechanisms of obesity in transgenic mice overexpressing neuropeptide Y

Neuropeptide Y (NPY) is a neurotransmitter promoting energy storage by activating Y-receptors and thus affecting food intake, thermogenesis and adipose tissue metabolism. NPY is expressed both in the central and sympathetic nervous system. Hypothalamic NPY is known to stimulate feeding, but the effects of noradrenergic neuron NPY are more ambiguous. Chronic stress stimulates fat accumulation via NPY release from noradrenergic neurons. Furthermore, polymorphism in the human Npy gene has been associated with metabolic disturbances and increased NPY secretion after sympathetic stimulation. The main objective of this study was to clarify the mechanisms of noradrenergic neuron NPY in the development of obesity. The metabolic phenotype of a homozygous mouse overexpressing NPY in the brain noradrenergic neurons and sympathetic nervous system (OE-NPYDβH mouse) was characterized. OE-NPYDβH mice had an increased fat mass and body weight, which caused impairments of glucose metabolism and hyperinsulinaemia with age. There were no differences in energy intake or expenditure, but the sympathetic tone was down-regulated and the endocannabinoid system activated. Furthermore, peripheral Y2-receptors in energy-rich conditions played an important role in mediating the fat-accumulating effect of NPY. These results indicate that noradrenergic neuron NPY promotes obesity via direct effects in the periphery and by modulating the sympatho-adrenal and endocannabinoid systems. Additionally, NPY in the central noradrenergic neurons is believed to possess many important roles. The phenotype of the OE-NPYDβH mouse resembles the situations of chronic stress and Npy gene polymorphism and thus these mice may be exploited in testing novel drug candidates for the treatment of obesity.

The study of ligand binding specificities of the lipid binding proteins : recombinant human a-tocopherol transport protein (a-ttp), supernatant protein factor (spf) and S. cerevisiae Sec 14p for vitamin e (rrr-a-tocopherol) and other hydrophobic ligands.

One of the various functions of proteins in biological systems is the transport of small molecules, for this purpose proteins have naturally evolved special mechanisms to allow both ligand binding and its subsequent release to a target site; a process fundamental to many biological processes. Transport of Vitamin E (a-tocopherol), a lipid soluble antioxidant, to membranes helps in the protection of polyunsaturated fatty acids against peroxidative damage. In this research, the ligand binding characteristics of several members of the CRALTRIO family of lipid binding proteins was examined; the recombinant human a-Tocopherol Transfer Protein (a-TIP), Supernatant Protein Factor (SPF)ffocopherol Associated Protein (TAP), Cellular Retinaldehyde Binding Protein (CRALBP) and the phosphatidylinositol transfer protein from S. cerevisiae Sec 14p. Recombinant Sec 14p was expressed and purified from E. coli for comparison of tocopherol binding to the two other recombinant proteins postulated to traffic a-tocopherol. Competitive binding assays using [3H]-a-tocopherol and Lipidex-l000 resin allowed determination of the dissociation constants ~) of the CRAL-TRIO proteins for a-tocopherol and - 20 hydrophobic ligands for evaluation of the possible biological relevance of the binding interactions observed. The KIs (nM) for RRR-a-tocopherol are: a-TIP: 25.0, Sec 14p: 373, CRALBP: 528 and SPFffAP: 615. This indicates that all proteins recognize tocopherol but not with the same affinity. Sec 14p bound its native ligand PI with a KI of381 whereas SPFffAP bound PI (216) and y-tocopherol (268) similarly in contrast to the preferential binding ofRRR-a-tocopherol by a-TIP. Efforts to adequately represent biologically active SPFff AP involved investigation of tocopherol binding for several different recombinant proteins derived from different constructs and in the presence of different potential modulators (Ca+2, Mg+2, GTP and GDP); none of these conditions enhanced or inhibited a-tocopherol binding to SPF. This work suggests that only aTTP serves as the physiological mediator of a-tocopherol, yet structural homology between proteins allows common recognition of similar ligand features. In addition, several photo-affmity analogs of a-tocopherol were evaluated for their potential utility in further elucidation of a-TTP function or identification of novel tocopherol binding proteins.

The Elucidation of the involvement of endonuclease DNase y in reducing DNA transfection efficiency in mammalian cells

Gene therapy is predicated upon efficient gene transfer. While viral vectors are the method of choice for transformation efficiency, the immunogenicity and safety concerns remain problematic. Non-viral vectors, on the other hand, have shown high degrees of safety and are mostly non-immunogenic in nature. However, non-viral vectors usually suffer from low levels oftransformation efficiency and transgene expression. Thus, increasing transformation efficiency ofnon-viral vectors, in particular by calcium phosphate co-precipitation technique, is a way of generating a suitable vector for gene therapy and is the aim of this study. It is a long known fact that different cell lines have different transfection efficiencies regardless oftransfection methodology (Lin et a!., 1994). Using commonly available cell lines Madine-Darby Bovine Kidney (MDBK), HeLa and Human Embryonic Kidney (HEK-293), we have shown a decreasing trend ofDNase activity based on a plasmid digestion assay. From densitometry studies, as much as a 40% reduction in DNase activity was observed when comparing HEK-293 (least active) to MDBK (most active). Using various biochemical assays, it was determined that DNase y, in particular, was expressed more highly in MDBK cells than both HeLa and HEK-293. Upon cloning of the bovine DNase y gene, we utilized the sequence information to construct antisense expressing plasmids via both traditional antisense RNA (pASDGneoM) and siRNA (psiRNA-S4, psiRNA-S11 and psiRNA-S16). For the construction ofpASDGneoM, the 3' end of the DNase y was inserted in opposite orientation under a cytomegalovirus (CMV) promoter such that the expression ofRNA complementary to the DNase 2 ymRNA occurred. For siRNA plasmids, the sequence was screened to yield optimal short sequences for siRNA inhibition. The silencing ofbovine DNase y led to an increase in transfection efficiency based on traditional calcium phosphate co-precipitation technique; stable clones of siRNA-producing MDBK cell lines (psiRNA-S4 Bland psiRNA-S4 B4) both demol).strated 4-fold increases in transfection efficiency. Furthermore, serial transfection of antisense DNase y plasmid pASDGneoM and reporter pCMV-~ showed a maximum of 8-fold increase in transfection efficiency when the two separate transfections were carried out 4 hours apart (i.e. transfection ofpASDGneoM, separated by four hours, then transfection ofpCMV-~). Together, these results demonstrate the involvement ofDNase y in reducing transfection efficiency, at least by traditional calcium phosphate technique.

Assessment of chromatin activity in mouse and human tissues

Pancreatic deoxyribonuclease preferentially digests active genes during all phases of the cell cycle including mitosis. Recently, a DNAse I-directed in ~ nick translation technique has been used to demonstrate differences in the DNAse I sensitivity of euchromatic and heterochromatic regions of mitotic chromosomes. This ill ~ technique has been used in this study to ask whether facultative heterochromatin of the inactive X chromosome can be distinguished from the active X chromosome in mouse and human tissues. In addition to this, in ~ nick translation has been used to distinguish constitutive heterochromatin in mouse and human mitotic chromosomes. Based on relative levels of DNAse I sensitivity, the inactive X chromosome could not be distinguished from the active X chromosome in either mouse or human tissues but regions of constitutive heterochromatin could be distinguished by their relative DNAse I insensitivity. The use of !D situ nick translation was also applied to tissue sections of 7.5 day mouse embryos to ask whether differing levels of DNAse I sensitivity could be detected between different tissue types. Differences in DNAse I sensitivities were detected in three tissues examined; embryonic ectoderm, an embryo-derived tissue, and two extraembryonic tissues, extraembryonic ectoderm and ectoplacental cone. Embryonic ectoderm and extraembryonic ectoderm nuclei possessed comparable levels of DNAse I sensitivity while ectoplacental cone was significantly less DNAse I sensitive. This suggests that tissue-specific mechanisms such as chromatin structure may be involved in the regulation of gene activity in certain tissue types. This may also shed some light on possible tissue specific mechanisms regulating X chromosome activity in the developing mouse embryo.

Permissivity of human HeLa cells to bovine adenovirus type 2 (BaV2 infection

Infection of hUlnan cells by bovine adenovirlls type 2 (BAV2) is abortive. To obtain a better understanding of this pllenomel1011, and in particular to identify Wllich steps in the viral replicative cycles are altered dllring this virlls-host cells interaction, we have llndertaken a detailed study of BAV2 infections of the nonpennissive hUlnan IIeLa cells. Using autoradiography and 3H-thymidine-labeled vvhole virus particles for infection of HeLa cells, vve determined that viral attachluent appears normal. Furthermore, Southern analysis revealed that internalization and transport to the nuclells occurs in BAV2 infected HeLa cells. To investigate viral DNi\ synthesis, infectivity assays involving hydroxyllrea, a viral DN-A synthesis inhibitor, were carried out. The results revealed that Bft:LV2 DNA synthesis does not occur in HeLa cells. Fllrtller investigations into viral early gene expression by northern blotting analyses indicated that HeLa cells fail to support expression of EIA. This suggested that abortive infection by BAV2 could be attributed to faiiure of EIA to express. To test the possibility that the failure to express ElA was due to the inability of the host cell to recognize the E lA prOlTIoter, ,ve carried out transient expression transfection experiments using plaslnids \vith the bacterial lacZ linder the control of either BAV2 or i\d5 EIA promoter. X-gal histochelIlical assays sho\ved expression of lacZ from the Ad5 ElA prOlnoter but no expression of lacZ [rOln the BAV2 EIA prOlTIoter. This further suggests that the abortive infection b:y BAV2 could be attributed to failure of EIA to express dlle to a nonfllnctional prOlTIoter in hlunan cells. Thus we speClllated that abortive infection of HeLa cells by adenoviruses may be averted by providing EtA functions in trans. To demonstrate this, we coinfected HeLa cells with Ad5 and BAV2, reasoning that Ad5 could cOlnpensate for EIA deficiency in BAV2. OUf results showed that BAV2 DNA synthesis was indeed Sllpported in HeLa cells coinfected with Ad5dlE3 as revealed by Southern analysis. In contrast, coinfection of HeLa cells \vith BAV2 and Ad5dlElE3 mutallt did not support BLt\V2 DNA synthesis. Interestingly, BAV2 failed to replicate in 293 cells which are constitlltively expressing the El genes. This could ilnply that El is necessary but not sufficient to avert the failllre ofBAV2 to undergo productive infection ofhulnan cells.

The human right to water - normative foundations and ethical implications

La présente contribution examine les fondements normatifs ainsi que les implications éthiques du droit à l’eau, tel qu’il fut reconnu en 2002 par le comité onusien des droits économiques, sociaux et culturels. Il sera défendu que le droit à l’eau potable peut être justifié en tant que droit moral fondamental, de par son caractère indispensable en vue de la garantie des conditions basiques de survie. Cet état de fait, cependant, s’avère moins évident au vue d’un droit à l’eau d’usage non-domestique. Ici, la discussion se rapproche des débats accompagnant le concept beaucoup plus complexe des droits sociaux et économiques. Par rapport à ce groupe de droits, la question de l’allocation est des plus controversées: à qui incombe-t-il de garantir leur respect? Dans le but d’éviter cette problématique d’allocation, le présent essai soulèvera la question de savoir, si la limitation de l’accès à l’eau peut être conçue comme une violation d’autres droits moraux: bien qu’il y ait des cas où des entreprises transnationales déploient des activités nuisibles à l’égard des populations pauvres en polluant sciemment leurs ressources en eau ou en initiant et en exécutant des stratégies de privatisation les privant de leurs droits, la crise globale de l’eau ne saura être rattachée uniquement aux effets de la mondialisation. Plutôt, l’on reconnaîtra la nécessité d’efforts positifs et soutenus de la part des pays développés en vue de la réalisation d’un approvisionnement suffisant en eau pour tous.

Blood, fire and fertility : human remains and ritual practices at the temple pyramid groups of Cantona, Puebla, Mexico

La ville préhispanique de Cantona, située dans la vallée d’Oriental dans l’état de Puebla au Mexique, atteignit sa première apogée culturelle entre 150 av. J.C. et 600/650 A.D. Durant cette période, des complexes cérémoniaux comprenant des groupes de pyramides-temples et des terrains de jeu de balle furent construits. Ces installations servirent au déroulement de nombreux rites au cours desquels les victimes de sacrifices étaient décapitées, démembrées, décharnées, écorchées, bouillies, brûlées et, dans certains cas, consommées. D’autres traitements du corps humain comportent l’inhumation d’individus en position assise et repliés sur eux-mêmes. Pour mieux comprendre le traitement mortuaire rituel des corps humains à Cantona, les découvertes faites sur place sont comparées aux données datant de la même époque obtenues dans trois régions voisines : la vallée de Mexico, Puebla-Tlaxcala et le golfe du Mexique. A partir de ces renseignements, on peut en déduire que la majorité des découvertes faites à Cantona sont les restes des dépouilles et offrandes provenant de rites destinés à la communication avec les dieux et à l’obtention de la fertilité, tandis que les dépouilles des individus en position assise appartiennent à des prêtres ou à des personnages religieux.

Régions de susceptibilité dans les remaniements du chromosome Y et mosaïcisme : facteurs de risque du développement sexuel anormal

Le développement sexuel est un processus complexe qui dépend de nombreux gènes, une mutation pouvant entraîner un développement sexuel anormal. Par ailleurs, des anomalies chromosomiques peuvent avoir des répercussions importantes sur la détermination gonadique, surtout lorsqu'il s'agit du chromosome Y puisqu'il porte le gène clé du développement sexuel masculin. Premièrement, nous avons identifié par cytogénétique moléculaire le point de cassure chez 5 patients avec une translocation X;Y et 10 patients avec un chromosome Y isodicentrique. Nous avons ainsi démontré que certaines régions sont plus à risque d'être remaniées, notamment lorsqu'elles contiennent des palindromes ou d'autres séquences répétées. Nous avons également établi une relation entre la distance séparant le centromère et le point de cassure et l'instabilité des chromosomes Y isodicentriques lors des divisions cellulaires. Deuxièmement, nous avons étudié en cytogénétique les gonades de 22 patients avec un chromosome Y normal ou remanié et présentant un développement sexuel anormal. Nous avons mis en évidence la perte du chromosome Y remanié dans une majorité de cellules gonadiques des 10 patients étudiés, expliquant leur phénotype sexuel anormal. Cependant, chez 11 des 12 patients avec un chromosome Y normal, aucun mosaïcisme expliquant clairement leur détermination gonadique anormale n'a été retrouvé. Finalement, nous avons analysé par immunohistochimie les gonades dysgénésiques de 30 patients avec une anomalie du développement sexuel et un chromosome Y normal ou remanié. Nos travaux ont montré la présence de cellules germinales immatures au sein de cordons sexuels primitifs sous forme de tissu gonadique indifférencié dans 15 gonades, dont 9 ont évolué en tumeur gonadique. Dans 13 autres gonades, ces cellules germinales immatures avaient disparues par apoptose. Dans l'ensemble, notre recherche met en évidence la susceptibilité du chromosome Y à subir des remaniements et à être instable lors des divisions cellulaires, et indique que le mosaïcisme peut avoir des répercussions sur la détermination gonadique. Nos travaux montrent également que le tissu gonadique indifférencié peut évoluer vers deux entités, une tumeur gonadique ou une bandelette suite à l'apoptose des cellules germinales, mettant en lumière la nécessité d'analyser le tissu gonadique des patients XY avec dysgénésie gonadique dont les gonades sont laissées en place.