992 resultados para Bactérias aeróbicas gram-negativas (Fisiologia)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Odontologia - FOAR

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Ciências Biológicas (Botânica) - IBB

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Biologia Geral e Aplicada - IBB

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to evaluate the effects of kinetin and calcium applications on the physiologic and productive traits of soybean plants, subjected to drought and shade conditions, at flowering. A randomized complete block design was used, in a split-plot arrangement, with four replicates. Soybean plants cultivated in 38 dm³ pots were sprayed with calcium and kinetin, alone or mixed, and subjected to drought and shade during 12 days. After stress period, plants were cultivated under appropriate water and light availability. Calcium and kinetin application resulted in maintenance of the relative water content after four days of drought beginning. Membrane damage, measured at the end of stress period, was lower in plants sprayed with calcium and kinetin. CO2 assimilation diminished by stress condition, mainly under drought, and grain yield decreased at the same intensity in both environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The garlic (Allium sativum L.) can be naturally infected by a complex of filamentous viruses belonging to the genera Potyvirus, Carlavirus and Allexivirus. Accumulation of these viruses occurs especially by vegetative propagation through cloves. As the cultivated garlic plant does not produce true seed worldwide, virus-free plants can only be obtained by tissue culture of stem apices and thermotherapy. Using these techniques, garlic seeds were produced at the School of Agricultural Sciences - UNESP, Botucatu, and evaluated by RT-PCR for the presence of potyvirus, carlavirus and allexivirus. In the second generation of microcloves propagated in a greenhouse, 6.6% infection was detected, only by allexivirus. In the fourth generation, however, there was 60% incidence by allexivirus, 35% by potyvirus and all negative by carlavirus. The high rate of infection by allexivirus may be related to the greater difficulty of removing the species of viruses belonging to this genus, as observed by other authors, and also based on the infection and transmission of the virus by the mite, Aceria tulipae, during the storage of bulbs from one year to the other. The garlic at the fourth generation corresponds to cloves weighed less than 1 gram and not selected for commercial multiplication. Selection for the size of cloves has a positive effect on the choice of cloves with lower rates of viral infection, as the technique of thermotherapy and tissue culture do not eliminate the virus completely. Results also emphasize the need of fumigation for the garlic seed stored from one year to the other in order to prevent the transmission of allexivirus during storage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The persistence of MCs in aquatic environments and their difficult removal in the conventional water treatment is a challenge to companies of sanitation. However, the MCs are susceptible to degradation by bacteria present in water, sediment and sewage effluents. In this study, we investigated the biodegradation of MCs by microorganism present in carbon filters with biological activity (BAC) and their phylogenetic identification by sequencing gene 16S RNA. A study of water containing MCs was used, with different compositions, plus a filters BAC effluent. The results showed that of MCs were biodegraded by microorganism present in the biofilm. This study provides the ability to complete biodegradation of MCs by bacteria present in BAC filters and the possible use of these microorganisms as alternative of the removal of MCs in the treatment of drinking water

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Biometria - IBB

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Agronomia (Produção Vegetal) - FCAV

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Agronomia (Agricultura) - FCA