From protein microarray to biology: The discovery of epigenetic regulatory molecules

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Evolution of cis-regulatory elements in a repetitive sequence adjacent to a sea urchin aboral ectoderm -specific gene

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Localization of ion-regulatory epithelia in embryos and hatchlings of two cephalopods

The tissue distribution and ontogeny of Na+/K+-ATPase has been examined as an indicator for ion-regulatory epithelia in whole animal sections of embryos and hatchlings of two cephalopod species: the squid Loligo vulgaris and the cuttlefish Sepia officinalis. This is the first report of the immunohistochemical localization of cephalopod Na+/K+-ATPase with the polyclonal antibody alpha (H-300) raised against the human alpha1-subunit of Na+/K+-ATPase. Na+/K+-ATPase immunoreactivity was observed in several tissues (gills, pancreatic appendages, nerves), exclusively located in baso-lateral membranes lining blood sinuses. Furthermore, large single cells in the gill of adult L. vulgaris specimens closely resembled Na+/K+-ATPase-rich cells described in fish. Immunohistochemical observations indicated that the amount and distribution of Na+/K+-ATPase in late cuttlefish embryos was similar to that found in juvenile and adult stages. The ion-regulatory epithelia (e.g., gills, excretory organs) of the squid embryos and paralarvae exhibited less differentiation than adults. Na+/K+-ATPase activities for whole animals were higher in hatchlings of S. officinalis (157.0 ± 32.4 µmol/g FM/h) than in those of L. vulgaris (31.8 ± 3.3 µmol/g FM/h). S. officinalis gills and pancreatic appendages achieved activities of 94.8 ± 18.5 and 421.8 ± 102.3 µmol ATP/g FM/h, respectively. High concentrations of Na+/K+-ATPase in late cephalopod embryos might be important in coping with the challenging abiotic conditions (low pH, high pCO2) that these organisms encounter inside their eggs. Our results also suggest a higher sensitivity of squid vs. cuttlefish embryos to environmental acid-base disturbances.

Why Do Economies Enter into Preferential Agreements on Trade in Services? Assessing the Potential for Negotiated Regulatory Convergence in Asian Services Markets

More than one-third of the World Trade Organization-notified services trade agreements that were in effect between January 2008 and August 2015 involved at least one South or Southeast Asian trading partner. Drawing on Baier and Bergstrand’s (2004) determinants of preferential trade agreements and using the World Bank’s database on the restrictiveness of domestic services regimes (Borchert, Gootiiz, and Mattoo 2012), we examine the potential for negotiated regulatory convergence in Asian services markets. Our results suggest that Asian economies with high levels of preexisting bilateral merchandise trade and wide differences in services regulatory frameworks are more likely candidates for services trade agreement formation. Such results lend support to the hypothesis that the heightened “servicification” of production generates demand for the lowered services input costs resulting from negotiated market openings.

Why do Countries Enter into Preferential Agreements on Trade in Services? Assessing the Potential for Negotiated Regulatory Convergence in Asian Services Markets

More than a third of the World Trade Organization (WTO)-notified services trade agreements (STAs) in effect over January 2008 - August 2015 have involved at least one (South or Southeast) Asian trading partner. Drawing on Baier and Bergstrand's (2004) determinants of preferential trade agreements and using the World Bank's database on the restrictiveness of domestic services regimes (Borchert et.al. 2012), we examine the potential for negotiated regulatory convergence in Asian services markets. Our results suggest that countries within Asia with high levels of pre-existing bilateral merchandise trade and wide differences in services regulatory frameworks are more likely candidates for STA formation. Such results lend support to the hypothesis that the heightened "servicification" of production generates a demand for the lowered service input costs resulting from negotiated market opening.

Success possibilities of grid parity in particular cases in the new spanish regulatory framework

During the last 10 years the Spanish photovoltaic market has experienced one of the most important increases worldwide. The continuous raise on the price of the electricity in Spain, as in other European countries, USA and Japan, as well as the decrease of the cost of solar photovoltaic systems along this decade is opening a new way to reach grid parity point in some particular scenarios. A new Spanish legislation is being performed toward selfconsumption, and it is in this new context where the grid parity in a wide sense could be achieved. This work will study different cases in Spain, in order to determine whether grid parity would be possible along 2012. Keywords: grid parity, self-consumption, photovoltaic, net-metering

Risk sharing with Multilateral Financial Institutions in infrastructure and energy project financing : effect on capital relief for commercial banks

(Matsukawa and Habeck, 2007) analyse the main instruments for risk mitigation in infrastructure financing with Multilateral Financial Institutions (MFIs). Their review coincided with the global financial crisis of 2007-08, and is highly relevant in current times considering the sovereign debt crisis, the lack of available capital and the increases in bank regulation in Western economies. The current macroeconomic environment has seen a slowdown in the level of finance for infrastructure projects, as they pose a higher credit risk given their requirements for long term investments. The rationale for this work is to look for innovative solutions that are focused on the credit risk mitigation of infrastructure and energy projects whilst optimizing the economic capital allocation for commercial banks. This objective is achieved through risk-sharing with MFIs and looking for capital relief in project finance transactions. This research finds out the answer to the main question: "What is the impact of risk-sharing with MFIs on project finance transactions to increase their efficiency and viability?", and is developed from the perspective of a commercial bank assessing the economic capital used and analysing the relevant variables for it: Probability of Default, Loss Given Default and Recovery Rates, (Altman, 2010). An overview of project finance for the infrastructure and energy sectors in terms of the volume of transactions worldwide is outlined, along with a summary of risk-sharing financing with MFIs. A review of the current regulatory framework beneath risk-sharing in structured finance with MFIs is also analysed. From here, the impact of risk-sharing and the diversification effect in infrastructure and energy projects is assessed, from the perspective of economic capital allocation for a commercial bank. CreditMetrics (J. P. Morgan, 1997) is applied over an existing well diversified portfolio of project finance infrastructure and energy investments, working with the main risk capital measures: economic capital, RAROC, and EVA. The conclusions of this research show that economic capital allocation on a portfolio of project finance along with risk-sharing with MFIs have a huge impact on capital relief whilst increasing performance profitability for commercial banks. There is an outstanding diversification effect due to the portfolio, which is combined with risk mitigation and an improvement in recovery rates through Partial Credit Guarantees issued by MFIs. A stress test scenario analysis is applied to the current assumptions and credit risk model, considering a downgrade in the rating for the commercial bank (lender) and an increase of default in emerging countries, presenting a direct impact on economic capital, through an increase in expected loss and a decrease in performance profitability. Getting capital relief through risk-sharing makes it more viable for commercial banks to finance infrastructure and energy projects, with the beneficial effect of a direct impact of these investments on GDP growth and employment. The main contribution of this work is to promote a strategic economic capital allocation in infrastructure and energy financing through innovative risk-sharing with MFIs and economic pricing to create economic value added for banks, and to allow the financing of more infrastructure and energy projects. This work suggests several topics for further research in relation to issues analysed. (Matsukawa and Habeck, 2007) analizan los principales instrumentos de mitigación de riesgos en las Instituciones Financieras Multilaterales (IFMs) para la financiación de infraestructuras. Su presentación coincidió con el inicio de la crisis financiera en Agosto de 2007, y sus consecuencias persisten en la actualidad, destacando la deuda soberana en economías desarrolladas y los problemas capitalización de los bancos. Este entorno macroeconómico ha ralentizado la financiación de proyectos de infraestructuras. El actual trabajo de investigación tiene su motivación en la búsqueda de soluciones para la financiación de proyectos de infraestructuras y de energía, mitigando los riesgos inherentes, con el objeto de reducir el consumo de capital económico en los bancos financiadores. Este objetivo se alcanza compartiendo el riesgo de la financiación con IFMs, a través de estructuras de risk-sharing. La investigación responde la pregunta: "Cuál es el impacto de risk-sharing con IFMs, en la financiación de proyectos para aumentar su eficiencia y viabilidad?". El trabajo se desarrolla desde el enfoque de un banco comercial, estimando el consumo de capital económico en la financiación de proyectos y analizando las principales variables del riesgo de crédito, Probability of Default, Loss Given Default and Recovery Rates, (Altman, 2010). La investigación presenta las cifras globales de Project Finance en los sectores de infraestructuras y de energía, y analiza el marco regulatorio internacional en relación al consumo de capital económico en la financiación de proyectos en los que participan IFMs. A continuación, el trabajo modeliza una cartera real, bien diversificada, de Project Finance de infraestructuras y de energía, aplicando la metodología CreditMet- rics (J. P. Morgan, 1997). Su objeto es estimar el consumo de capital económico y la rentabilidad de la cartera de proyectos a través del RAROC y EVA. La modelización permite estimar el efecto diversificación y la liberación de capital económico consecuencia del risk-sharing. Los resultados muestran el enorme impacto del efecto diversificación de la cartera, así como de las garantías parciales de las IFMs que mitigan riesgos, mejoran el recovery rate de los proyectos y reducen el consumo de capital económico para el banco comercial, mientras aumentan la rentabilidad, RAROC, y crean valor económico, EVA. En escenarios económicos de inestabilidad, empeoramiento del rating de los bancos, aumentos de default en los proyectos y de correlación en las carteras, hay un impacto directo en el capital económico y en la pérdida de rentabilidad. La liberación de capital económico, como se plantea en la presente investigación, permitirá financiar más proyectos de infraestructuras y de energía, lo que repercutirá en un mayor crecimiento económico y creación de empleo. La principal contribución de este trabajo es promover la gestión activa del capital económico en la financiación de infraestructuras y de proyectos energéticos, a través de estructuras innovadoras de risk-sharing con IFMs y de creación de valor económico en los bancos comerciales, lo que mejoraría su eficiencia y capitalización. La aportación metodológica del trabajo se convierte por su originalidad en una contribución, que sugiere y facilita nuevas líneas de investigación académica en las principales variables del riesgo de crédito que afectan al capital económico en la financiación de proyectos.

El análisis de la dirección integrada de proyectos (project & construction management) en el marco europeo: propuesta de regulación en España y su inclusión en la ley de la ordenación de la edificación

El presente trabajo de Tesis Doctoral surge de la Figura de la Dirección Integrada de Proyecto en Edificación (“Project & Construction Management”) y su analisis de la situación regulatoria en la legislación española. El primer planteamiento fue pensar en la situación actual de esta figura en el contexto internacional, para analizar su repercusión en el sector de la edificación, lo cual me llevo a cabo las siguientes preguntas que he reuelto en esta investigación. ¿ Como surge el ¨Project & Construction Management”? ¿ Cuales son sus actividades, funciones y cometidos? ¿ Existe el ¨Project & Construction Management” en otros países? ¿Hay regulación del ¨Project & Construction Management” en esos paises? ¿Cómo es la regulación del ¨Project & Construction Management”? ¿Existe demanda del ¨Project & Construction Management” en España? ¿Cómo es esa demanda en España, y como se puede cuantificar? ¿Existe regulación del ¨Project & Construction Management” en España? ¿ Como debería ser la regulación del ¨Project & Construction Management” en España? Todas las preguntas anteriores las he ido respondiendo con el presente trabajo, llegando a una serie de respuestas, que están reflejadas en el desarrollo del presente trabajo y que resumo: - EL ¨Project & Construction Management” surge a principios del siglo XX en USA, desarrollándose como una disciplina con metodología propia y extendiéndose por otros países. - EL ¨Project & Construction Management” es una disciplina, basada en una metodología propia con herramientas y técnicas para organizar cualquier 14 proyecto de cualquier tipo, pero en este caso un proyecto de edificación, para lo cual he definido con todo detalle esta figura. - El origen del ¨Project & Construction Management” es anglosajón, concretamente en USA, extendiendose luego al Reino Unido, a Europa (Francia y Alemania), a Asia, a América del Sur y a Oceanía. - En todos los paises estudiados (Estados Unidos, Reino Unido, Francia y Alemania) existe una regulación sobre el ¨Project & Construction Management” que me ha servido de base comparativa para introducirla en España. - Hay muchas empresas en España (Nacionales e Internacionales) que ejercen su actividad dentro de este sector, por lo que para realizar un estudio más profundo, hice una muestra de las 30 empresas más significativas, prepare un cuestionario, dividido en 5 apartados: Organizativo, Sectorial, Cualitativo, Cuantitativo y Profesional para obtener una radiogradía de la situación real del sector, y así valorar cual es la importancia de este agente. - Estudié las posibles regulaciones del ¨Project & Construction Management” en España y no encontré ninguna. - El lugar idóneo para que se regule al ¨Project & Construction Management” es la Ley de Ordenación de la Edificación (LOE), ya que la jurisprudencia (sentencias de los tribunales de justicia españoles) le ha asimilado con los agentes de la LOE y se ha basado para absolver o condenar en la Ley de Ordenación de la Edificación. Por lo que el Objetivo fundamental de esta tesis ha sido regular la figura del ¨Project & Construction Management”, traducirla al Castellano, definirla y realizar una estructura de Agente de la Edificación, según la LOE, para poder introducirla dentro de la Legislación Española, con el objeto de mejorar la calidad de la edificación, proteger al usuario, estableciendo responsabilidades y garantías y proteger al ¨Project & Construction Management” de las responsabilidades solidarias. ABSTRACT This Doctoral Thesis figure emerges from the Integrated Building Project ("Project & Construction Management") and his analysis of the regulatory situation in the Spanish legislation. The first approach was to think of the current situation of this figure in the international context, to analyze its impact on the building sector, which I conducted the following questions that I have met in this research. - How did the “Project & Construction Management "? - What are your activities, functions and duties? - Is there a “Project & Construction Management "in other countries? - Is there regulation “Project & Construction Management "in these countries? - How is regulation of ¨ Project & Construction Management "? - Is there demand “Project & Construction Management "in Spain? - How is that demand in Spain, and as you can quantify? - Is there regulation “Project & Construction Management "in Spain? - How should regulation ¨Project & Construction Management "in Spain? All the above questions have been answered with this study, leading to a series of responses, which are reflected in the development of this study and are summarized: - The ¨ Project & Construction Management "comes early twentieth century in the USA, developed as a discipline with its own methodology and extending other countries. - The ¨ Project & Construction Management "is a discipline based on a metodology own tools and techniques to organize any project of any kind, but in this case a building project, for which I have defined in detail this figure. - The origin of ¨Project & Construction Management "is Anglo-Saxon, particularly in USA, then spreading to the UK, Europe (France and Germany), Asia, South America and Oceania. - In all countries studied (USA, UK, France and Germany) there is a regulation on ¨Project & Construction Management "has helped me to introduce comparative base in Spain. - There are many companies in Spain (National and International) who perform work within this sector, so for further study, I made a sample of the 30 most important companies, prepare a questionnaire, divided into five sections: Organizational , Sector, Qualitative, Quantitative and Professional radiography for a real situation of the sector, and thus assess which is the importance of this agent. - Study the possible regulations ¨Project & Construction Management "in Spain and found none. - The place to be regulated to ¨Project & Construction Management "is the Law of Construction Planning (LOE), as the case law (judgments of the courts Spanish) has assimilated LOE agents and has been based to absolve or condemn Law Construction Planning. So the objective of this thesis has been regular figure ¨ Project & Construction Management ", translated to spanish, define and perform an Agent structure of the Building, as the LOE, to enter into Spanish law, in order to improve the quality of the building, protecting the user, establishing responsibilities and guarantees and protect the ¨ Project & Construction Management "solidarity responsibilities.

Propuestas regulatorias para el diseño de un mercado ibérico a plazo eficiente de la energía = Regulatory proposals for the development of an efficient iberian energy forward market

El mercado ibérico de futuros de energía eléctrica gestionado por OMIP (“Operador do Mercado Ibérico de Energia, Pólo Português”, con sede en Lisboa), también conocido como el mercado ibérico de derivados de energía, comenzó a funcionar el 3 de julio de 2006. Se analiza la eficiencia de este mercado organizado, por lo que se estudia la precisión con la que sus precios de futuros predicen el precio de contado. En dicho mercado coexisten dos modos de negociación: el mercado continuo (modo por defecto) y la contratación mediante subasta. En la negociación en continuo, las órdenes anónimas de compra y de venta interactúan de manera inmediata e individual con órdenes contrarias, dando lugar a operaciones con un número indeterminado de precios para cada contrato. En la negociación a través de subasta, un precio único de equilibrio maximiza el volumen negociado, liquidándose todas las operaciones a ese precio. Adicionalmente, los miembros negociadores de OMIP pueden liquidar operaciones “Over-The-Counter” (OTC) a través de la cámara de compensación de OMIP (OMIClear). Las cinco mayores empresas españolas de distribución de energía eléctrica tenían la obligación de comprar electricidad hasta julio de 2009 en subastas en OMIP, para cubrir parte de sus suministros regulados. De igual manera, el suministrador de último recurso portugués mantuvo tal obligación hasta julio de 2010. Los precios de equilibrio de esas subastas no han resultado óptimos a efectos retributivos de tales suministros regulados dado que dichos precios tienden a situarse ligeramente sesgados al alza. La prima de riesgo ex-post, definida como la diferencia entre los precios a plazo y de contado en el periodo de entrega, se emplea para medir su eficiencia de precio. El mercado de contado, gestionado por OMIE (“Operador de Mercado Ibérico de la Energía”, conocido tradicionalmente como “OMEL”), tiene su sede en Madrid. Durante los dos primeros años del mercado de futuros, la prima de riesgo media tiende a resultar positiva, al igual que en otros mercados europeos de energía eléctrica y gas natural. En ese periodo, la prima de riesgo ex-post tiende a ser negativa en los mercados de petróleo y carbón. Los mercados de energía tienden a mostrar niveles limitados de eficiencia de mercado. La eficiencia de precio del mercado de futuros aumenta con el desarrollo de otros mecanismos coexistentes dentro del mercado ibérico de electricidad (conocido como “MIBEL”) –es decir, el mercado dominante OTC, las subastas de centrales virtuales de generación conocidas en España como Emisiones Primarias de Energía, y las subastas para cubrir parte de los suministros de último recurso conocidas en España como subastas CESUR– y con una mayor integración de los mercados regionales europeos de energía eléctrica. Se construye un modelo de regresión para analizar la evolución de los volúmenes negociados en el mercado continuo durante sus cuatro primeros años como una función de doce indicadores potenciales de liquidez. Los únicos indicadores significativos son los volúmenes negociados en las subastas obligatorias gestionadas por OMIP, los volúmenes negociados en el mercado OTC y los volúmenes OTC compensados por OMIClear. El número de creadores de mercado, la incorporación de agentes financieros y compañías de generación pertenecientes a grupos integrados con suministradores de último recurso, y los volúmenes OTC compensados por OMIClear muestran una fuerte correlación con los volúmenes negociados en el mercado continuo. La liquidez de OMIP está aún lejos de los niveles alcanzados por los mercados europeos más maduros (localizados en los países nórdicos (Nasdaq OMX Commodities) y Alemania (EEX)). El operador de mercado y su cámara de compensación podrían desarrollar acciones eficientes de marketing para atraer nuevos agentes activos en el mercado de contado (p.ej. industrias consumidoras intensivas de energía, suministradores, pequeños productores, compañías energéticas internacionales y empresas de energías renovables) y agentes financieros, captar volúmenes del opaco OTC, y mejorar el funcionamiento de los productos existentes aún no líquidos. Resultaría de gran utilidad para tales acciones un diálogo activo con todos los agentes (participantes en el mercado, operador de mercado de contado, y autoridades supervisoras). Durante sus primeros cinco años y medio, el mercado continuo presenta un crecimento de liquidez estable. Se mide el desempeño de sus funciones de cobertura mediante la ratio de posición neta obtenida al dividir la posición abierta final de un contrato de derivados mensual entre su volumen acumulado en la cámara de compensación. Los futuros carga base muestran la ratio más baja debido a su buena liquidez. Los futuros carga punta muestran una mayor ratio al producirse su menor liquidez a través de contadas subastas fijadas por regulación portuguesa. Las permutas carga base liquidadas en la cámara de compensación ubicada en Madrid –MEFF Power, activa desde el 21 de marzo de 2011– muestran inicialmente valores altos debido a bajos volúmenes registrados, dado que esta cámara se emplea principalmente para vencimientos pequeños (diario y semanal). Dicha ratio puede ser una poderosa herramienta de supervisión para los reguladores energéticos cuando accedan a todas las transacciones de derivados en virtud del Reglamento Europeo sobre Integridad y Transparencia de los Mercados de Energía (“REMIT”), en vigor desde el 28 de diciembre de 2011. La prima de riesgo ex-post tiende a ser positiva en todos los mecanismos (futuros en OMIP, mercado OTC y subastas CESUR) y disminuye debido a la curvas de aprendizaje y al efecto, desde el año 2011, del precio fijo para la retribución de la generación con carbón autóctono. Se realiza una comparativa con los costes a plazo de generación con gas natural (diferencial “clean spark spread”) obtenido como la diferencia entre el precio del futuro eléctrico y el coste a plazo de generación con ciclo combinado internalizando los costes de emisión de CO2. Los futuros eléctricos tienen una elevada correlación con los precios de gas europeos. Los diferenciales de contratos con vencimiento inmediato tienden a ser positivos. Los mayores diferenciales se dan para los contratos mensuales, seguidos de los trimestrales y anuales. Los generadores eléctricos con gas pueden maximizar beneficios con contratos de menor vencimiento. Los informes de monitorización por el operador de mercado que proporcionan transparencia post-operacional, el acceso a datos OTC por el regulador energético, y la valoración del riesgo regulatorio pueden contribuir a ganancias de eficiencia. Estas recomendaciones son también válidas para un potencial mercado ibérico de futuros de gas, una vez que el hub ibérico de gas –actualmente en fase de diseño, con reuniones mensuales de los agentes desde enero de 2013 en el grupo de trabajo liderado por el regulador energético español– esté operativo. El hub ibérico de gas proporcionará transparencia al atraer más agentes y mejorar la competencia, incrementando su eficiencia, dado que en el mercado OTC actual no se revela precio alguno de gas. ABSTRACT The Iberian Power Futures Market, managed by OMIP (“Operador do Mercado Ibérico de Energia, Pólo Português”, located in Lisbon), also known as the Iberian Energy Derivatives Market, started operations on 3 July 2006. The market efficiency, regarding how well the future price predicts the spot price, is analysed for this energy derivatives exchange. There are two trading modes coexisting within OMIP: the continuous market (default mode) and the call auction. In the continuous trading, anonymous buy and sell orders interact immediately and individually with opposite side orders, generating trades with an undetermined number of prices for each contract. In the call auction trading, a single price auction maximizes the traded volume, being all trades settled at the same price (equilibrium price). Additionally, OMIP trading members may settle Over-the-Counter (OTC) trades through OMIP clearing house (OMIClear). The five largest Spanish distribution companies have been obliged to purchase in auctions managed by OMIP until July 2009, in order to partly cover their portfolios of end users’ regulated supplies. Likewise, the Portuguese last resort supplier kept that obligation until July 2010. The auction equilibrium prices are not optimal for remuneration purposes of regulated supplies as such prices seem to be slightly upward biased. The ex-post forward risk premium, defined as the difference between the forward and spot prices in the delivery period, is used to measure its price efficiency. The spot market, managed by OMIE (Market Operator of the Iberian Energy Market, Spanish Pool, known traditionally as “OMEL”), is located in Madrid. During the first two years of the futures market, the average forward risk premium tends to be positive, as it occurs with other European power and natural gas markets. In that period, the ex-post forward risk premium tends to be negative in oil and coal markets. Energy markets tend to show limited levels of market efficiency. The price efficiency of the Iberian Power Futures Market improves with the market development of all the coexistent forward contracting mechanisms within the Iberian Electricity Market (known as “MIBEL”) – namely, the dominant OTC market, the Virtual Power Plant Auctions known in Spain as Energy Primary Emissions, and the auctions catering for part of the last resort supplies known in Spain as CESUR auctions – and with further integration of European Regional Electricity Markets. A regression model tracking the evolution of the traded volumes in the continuous market during its first four years is built as a function of twelve potential liquidity drivers. The only significant drivers are the traded volumes in OMIP compulsory auctions, the traded volumes in the OTC market, and the OTC cleared volumes by OMIClear. The amount of market makers, the enrolment of financial members and generation companies belonging to the integrated group of last resort suppliers, and the OTC cleared volume by OMIClear show strong correlation with the traded volumes in the continuous market. OMIP liquidity is still far from the levels reached by the most mature European markets (located in the Nordic countries (Nasdaq OMX Commodities) and Germany (EEX)). The market operator and its clearing house could develop efficient marketing actions to attract new entrants active in the spot market (e.g. energy intensive industries, suppliers, small producers, international energy companies and renewable generation companies) and financial agents as well as volumes from the opaque OTC market, and to improve the performance of existing illiquid products. An active dialogue with all the stakeholders (market participants, spot market operator, and supervisory authorities) will help to implement such actions. During its firs five and a half years, the continuous market shows steady liquidity growth. The hedging performance is measured through a net position ratio obtained from the final open interest of a month derivatives contract divided by its accumulated cleared volume. The base load futures in the Iberian energy derivatives exchange show the lowest ratios due to good liquidity. The peak futures show bigger ratios as their reduced liquidity is produced by auctions fixed by Portuguese regulation. The base load swaps settled in the clearing house located in Spain – MEFF Power, operating since 21 March 2011, with a new denomination (BME Clearing) since 9 September 2013 – show initially large values due to low registered volumes, as this clearing house is mainly used for short maturity (daily and weekly swaps). The net position ratio can be a powerful oversight tool for energy regulators when accessing to all the derivatives transactions as envisaged by European regulation on Energy Market Integrity and Transparency (“REMIT”), in force since 28 December 2011. The ex-post forward risk premium tends to be positive in all existing mechanisms (OMIP futures, OTC market and CESUR auctions) and diminishes due to the learning curve and the effect – since year 2011 – of the fixed price retributing the indigenous coal fired generation. Comparison with the forward generation costs from natural gas (“clean spark spread”) – obtained as the difference between the power futures price and the forward generation cost with a gas fired combined cycle plant taking into account the CO2 emission rates – is also performed. The power futures are strongly correlated with European gas prices. The clean spark spreads built with prompt contracts tend to be positive. The biggest clean spark spreads are for the month contract, followed by the quarter contract and then by the year contract. Therefore, gas fired generation companies can maximize profits trading with contracts of shorter maturity. Market monitoring reports by the market operator providing post-trade transparency, OTC data access by the energy regulator, and assessment of the regulatory risk can contribute to efficiency gains. The same recommendations are also valid for a potential Iberian gas futures market, once an Iberian gas hub – currently in a design phase, with monthly meetings amongst the stakeholders in a Working Group led by the Spanish energy regulatory authority since January 2013 – is operating. The Iberian gas hub would bring transparency attracting more shippers and improving competition and thus its efficiency, as no gas price is currently disclosed in the existing OTC market.

bZIP transcription factors in the regulatory networks controlling seed maturation and germination of Arabidopsis thaliana

Se describe la expresión por RTqPCR de los genes que codifican los factores transcripcionales bZIP44 y bZIP9. Asimismo se establece la interacción entre ambas proteínas en el sistema de 2 híbridos de levadura y in planta por complementación bimolecular fluorescente.