Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana.

Five different clones encoding thioredoxin homologues were isolated from Arabidopsis thaliana cDNA libraries. On the basis of the sequences they encode divergent proteins, but all belong to the cytoplasmic thioredoxins h previously described in higher plants. The five proteins obtained by overexpressing the coding sequences in Escherichia coli present typical thioredoxin activities (NADP(+)-malate dehydrogenase activation and reduction by Arabidopsis thioredoxin reductase) despite the presence of a variant active site, Trp-Cys-Pro-Pro-Cys, in three proteins in place of the canonical Trp-Cys-Gly-Pro-Cys sequence described for thioredoxins in prokaryotes and eukaryotes. Southern blots show that each cDNA is encoded by a single gene but suggest the presence of additional related sequences in the Arabidopsis genome. This very complex diversity of thioredoxins h is probably common to all higher plants, since the Arabidopsis sequences appear to have diverged very early, at the beginning of plant speciation. This diversity allows the transduction of a redox signal into multiple pathways.

Strand specificity in the transcriptional targeting of recombination at immunoglobulin switch sequences.

B-lymphocyte-specific class switch recombination is known to occur between pairs of 2- to 10-kb switch regions located immediately upstream of the immunoglobulin constant heavy-chain genes. Others have shown that the recombination is temporally correlated with the induction of transcription at the targeted switch regions. To determine whether this temporal correlation is due to a mechanistic linkage, we have developed an extrachromosomal recombination assay that closely recapitulates DNA deletional class switch recombination. In this assay, the rate of recombination is measured between 24 and 48 hr posttransfection. We find that recombinants are generated in a switch sequence-dependent manner. Recombination occurs with a predominance within B-cell lines representative of the mature B-cell stage and within a subset of pre-B-cell lines. Transcription stimulates the switch sequence-dependent recombination. Importantly, transcription activates recombination only when directed in the physiologic orientation but has no effect when directed in the nonphysiologic orientation.

The su(Hw) protein bound to gypsy sequences in one chromosome can repress enhancer-promoter interactions in the paired gene located in the other homolog.

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

Sets of EcoRI fragments containing ribosomal RNA sequences are conserved among different strains of Listeria monocytogenes.

To classify Listeria monocytogenes using taxonomic characters derived from the rRNA operons and their flanking sequences, we studied a sample of 1346 strains within the taxon. DNA from each strain was digested with a restriction endonuclease, EcoRI. The fragments were separated by gel electrophoresis, immobilized on a membrane, and hybridized with a labeled rRNA operon from Escherichia coli. The pattern of bands, positions, and intensities of hybridized fragments were electronically captured. Software was used to normalize the band positions relative to standards, scale the signal intensity, and reduce the background so that each strain was reproducibly represented in a data base as a pattern. With these methods, L. monocytogenes was resolved into 50 pattern types differing in the length of at least one polymorphic fragment. Pattern types representing multiple strains were recorded as the mathematical average of the strain patterns. Pattern types were arranged by size polymorphisms of assigned rRNA regions into subsets, which revealed the branching genetic structure of the species. Subtracting the polymorphic variants of a specific assigned region from the pattern types and averaging the types within each subset resulted in reduced sets of conserved fragments that could be used to recognize strains of the species. Pattern types and reduced sets of conserved fragments were conserved among different strains of L. monocytogenes but were not observed in total among strains of other species.

Types of Listeria monocytogenes predicted by the positions of EcoRI cleavage sites relative to ribosomal RNA sequences.

By using taxonomic characters derived from EcoRI restriction endonuclease digestion of genomic DNA and hybridization with a labeled rRNA operon from Escherichia coli, a polymorphic structure of Listeria monocytogenes, characterized by fragments with different frequencies of occurrence, was observed. This structure was expanded by creating predicted patterns through a recursive process of observation, expectation, prediction, and assessment of completeness. This process was applied, in turn, to normalized strain patterns, fragment bands, and positions of EcoRI recognition sites relative to rRNA regions. Analysis of 1346 strains provided observed patterns, fragment sizes, and their frequencies of occurrence in the patterns. Fragment size statistics led to the creation of unobserved combinations of bands, predicted pattern types. The observed fragment bands revealed positions of EcoRI sites relative to rRNA sequences. Each EcoRI site had a frequency of occurrence, and unobserved fragment sizes were postulated on the basis of knowing the restriction site locations. The result of the recursion process applied to the components of the strain data was an extended classification with observed and predicted members.

Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Proline-rich sequences that bind to Src homology 3 domains with individual specificities.

To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Chloroplast gene sequence data suggest a single origin of the predisposition for symbiotic nitrogen fixation in angiosperms.

Of the approximately 380 families of angiosperms, representatives of only 10 are known to form symbiotic associations with nitrogen-fixing bacteria in root nodules. The morphologically based classification schemes proposed by taxonomists suggest that many of these 10 families of plants are only distantly related, engendering the hypothesis that the capacity to fix nitrogen evolved independently several, if not many, times. This has in turn influenced attitudes toward the likelihood of transferring genes responsible for symbiotic nitrogen fixation to crop species lacking this ability. Phylogenetic analysis of DNA sequences for the chloroplast gene rbcL indicates, however, that representatives of all 10 families with nitrogen-fixing symbioses occur together, with several families lacking this association, in a single clade. This study therefore indicates that only one lineage of closely related taxa achieved the underlying genetic architecture necessary for symbiotic nitrogen fixation in root nodules.

Characterization of spatial–temporal patterns in dynamic speckle sequences using principal component analysis

Abstract. Speckle is being used as a characterization tool for the analysis of the dynamics of slow-varying phenomena occurring in biological and industrial samples at the surface or near-surface regions. The retrieved data take the form of a sequence of speckle images. These images contain information about the inner dynamics of the biological or physical process taking place in the sample. Principal component analysis (PCA) is able to split the original data set into a collection of classes. These classes are related to processes showing different dynamics. In addition, statistical descriptors of speckle images are used to retrieve information on the characteristics of the sample. These statistical descriptors can be calculated in almost real time and provide a fast monitoring of the sample. On the other hand, PCA requires a longer computation time, but the results contain more information related to spatial–temporal patterns associated to the process under analysis. This contribution merges both descriptions and uses PCA as a preprocessing tool to obtain a collection of filtered images, where statistical descriptors are evaluated on each of them. The method applies to slow-varying biological and industrial processes.

Deformable templates for plaque thickness estimation of intravascular ultrasound sequences

Comunicación presentada en el VII Symposium Nacional de Reconocimiento de Formas y Análisis de Imágenes, SNRFAI, Barcelona, abril 1997.

Deformable templates for tracking and analysis of intravascular ultrasound sequences

Deformable Template models are first applied to track the inner wall of coronary arteries in intravascular ultrasound sequences, mainly in the assistance to angioplasty surgery. A circular template is used for initializing an elliptical deformable model to track wall deformation when inflating a balloon placed at the tip of the catheter. We define a new energy function for driving the behavior of the template and we test its robustness both in real and synthetic images. Finally we introduce a framework for learning and recognizing spatio-temporal geometric constraints based on Principal Component Analysis (eigenconstraints).

Optimal synthesis of thermally coupled distillation sequences using a novel MILP approach

This paper introduces a novel MILP approach for the design of distillation columns sequences of zeotropic mixtures that explicitly include from conventional to fully thermally coupled sequences and divided wall columns with a single wall. The model is based on the use of two superstructure levels. In the upper level a superstructure that includes all the basic sequences of separation tasks is postulated. The lower level is an extended tree that explicitly includes different thermal states and compositions of the feed to a given separation task. In that way, it is possible to a priori optimize all the possible separation tasks involved in the superstructure. A set of logical relationships relates the feasible sequences with the optimized tasks in the extended tree resulting in a MILP to select the optimal sequence. The performance of the model in terms of robustness and computational time is illustrated with several examples.

A Sequential Algorithm for the Rigorous Design of Thermally Coupled Distillation Sequences

A sequential design method is presented for the design of thermally coupled distillation sequences. The algorithm starts by selecting a set of sequences in the space of basic configurations in which the internal structure of condensers and reboilers is explicitly taken into account and extended with the possibility of including divided wall columns (DWC). This first stage is based on separation tasks (except by the DWCs) and therefore it does not provide an actual sequence of columns. In the second stage the best arrangement in N-1 actual columns is performed taking into account operability and mechanical constraints. Finally, for a set of candidate sequences the algorithm try to reduce the number of total columns by considering Kaibel columns, elimination of transfer blocks or columns with vertical partitions. An example illustrate the different steps of the sequential algorithm.

A Novel Prediction Method for Early Recognition of Global Human Behaviour in Image Sequences

Human behaviour recognition has been, and still remains, a challenging problem that involves different areas of computational intelligence. The automated understanding of people activities from video sequences is an open research topic in which the computer vision and pattern recognition areas have made big efforts. In this paper, the problem is studied from a prediction point of view. We propose a novel method able to early detect behaviour using a small portion of the input, in addition to the capabilities of it to predict behaviour from new inputs. Specifically, we propose a predictive method based on a simple representation of trajectories of a person in the scene which allows a high level understanding of the global human behaviour. The representation of the trajectory is used as a descriptor of the activity of the individual. The descriptors are used as a cue of a classification stage for pattern recognition purposes. Classifiers are trained using the trajectory representation of the complete sequence. However, partial sequences are processed to evaluate the early prediction capabilities having a specific observation time of the scene. The experiments have been carried out using the three different dataset of the CAVIAR database taken into account the behaviour of an individual. Additionally, different classic classifiers have been used for experimentation in order to evaluate the robustness of the proposal. Results confirm the high accuracy of the proposal on the early recognition of people behaviours.