Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of the cholesterol 7$\alpha$-hydroxylase promoter in hypercholesterolemia -resistant rabbits

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^

Genetic integration of a nuclear -encoded mitochondrial gene with cardiac function

Cardiovascular disease (CVD) is the leading cause of death in the United States. One manifestation of CVD known to increase mortality is an enlarged, or hypertrophic heart. Hypertrophic cardiomyocytes adapt to increased contractile demand at the genetic level with a re-emergence of the fetal gene program and a downregulation of fatty acid oxidation genes with concomitant increased reliance on glucose-based metabolism. To understand the transcriptional regulatory pathways that implement hypertrophic directives we analyzed the upstream promoter region of the muscle specific isoform of the nuclear-encoded mitochondrial gene, carnitine palmitoyltransferase-1β (CPT-1β) in cultured rat neonatal cardiac myocytes. This enzyme catalyzes the rate-limiting step of fatty acid entry into β-oxidation and is downregulated in cardiac hypertrophy and failure, making it an attractive model for the study of hypertrophic gene regulation and metabolic adaptations. We demonstrate that the muscle-enriched transcription factors GATA-4 and SRF synergistically activate CPT-1β; moreover, DNA binding to cognate sites and intact protein structure are required. This mechanism coordinates upregulation of energy generating processes with activation of the energy consuming contractile promoter for cardiac α-actin. We hypothesized that fatty acid or glucose responsive transcription factors may also regulate CPT-1β. Oleate weakly stimulates CPT-1β activity; in contrast, the glucose responsive Upstream Stimulatory Factors (USF) dramatically depresses the CPT-1β reporter. USF regulates CPT-1β through a novel physical interaction with the cofactor PGC-1 and abrogation of MEF2A/PGC-1 synergistic stimulation. In this way, USF can inversely regulate metabolic gene programs and may play a role in the shift of metabolic substrate preference seen in hypertrophy. Failing hearts have elevated expression of the nuclear hormone receptor COUP-TF. We report that COUP-TF significantly suppresses reporter transcription independent of DNA binding and specific interactions with GATA-4, Nkx2.5 or USF. In summary, CPT-1β transcriptional regulation integrates mitochondrial gene expression with two essential cardiac functions: contraction and metabolic substrate oxidation. ^

Availability of sequences of aquatic and terrestrial taxa in genetic databases (GenBank and BOLD - the Barcode of Life Database) in 2010, 2012 and 2016

Correct species identifications are of tremendous importance for invasion ecology, as mistakes could lead to misdirecting limited resources against harmless species or inaction against problematic ones. DNA barcoding is becoming a promising and reliable tool for species identifications, however the efficacy of such molecular taxonomy depends on gene region(s) that provide a unique sequence to differentiate among species and on availability of reference sequences in existing genetic databases. Here, we assembled a list of aquatic and terrestrial non-indigenous species (NIS) and checked two leading genetic databases for corresponding sequences of six genome regions used for DNA barcoding. The genetic databases were checked in 2010, 2012, and 2016. All four aquatic kingdoms (Animalia, Chromista, Plantae and Protozoa) were initially equally represented in the genetic databases, with 64, 65, 69, and 61% of NIS included, respectively. Sequences for terrestrial NIS were present at rates of 58 and 78% for Animalia and Plantae, respectively. Six years later, the number of sequences for aquatic NIS increased to 75, 75, 74, and 63% respectively, while those for terrestrial NIS increased to 74 and 88% respectively. Genetic databases are marginally better populated with sequences of terrestrial NIS of plants compared to aquatic NIS and terrestrial NIS of animals. The rate at which sequences are added to databases is not equal among taxa. Though some groups of NIS are not detectable at all based on available data - mostly aquatic ones - encouragingly, current availability of sequences of taxa with environmental and/or economic impact is relatively good and continues to increase with time.

Oscillatory genetic circuits: new designs and mathematical models

Introduction and motivation: A wide variety of organisms have developed in-ternal biomolecular clocks in order to adapt to cyclic changes of the environment. Clock operation involves genetic networks. These genetic networks have to be mod¬eled in order to understand the underlying mechanism of oscillations and to design new synthetic cellular clocks. This doctoral thesis has resulted in two contributions to the fields of genetic clocks and systems and synthetic biology, generally. The first contribution is a new genetic circuit model that exhibits an oscillatory behav¬ior through catalytic RNA molecules. The second and major contribution is a new genetic circuit model demonstrating that a repressor molecule acting on the positive feedback of a self-activating gene produces reliable oscillations. First contribution: A new model of a synthetic genetic oscillator based on a typical two-gene motif with one positive and one negative feedback loop is pre¬sented. The originality is that the repressor is a catalytic RNA molecule rather than a protein or a non-catalytic RNA molecule. This catalytic RNA is a ribozyme that acts post-transcriptionally by binding to and cleaving target mRNA molecules. This genetic clock involves just two genes, a mRNA and an activator protein, apart from the ribozyme. Parameter values that produce a circadian period in both determin¬istic and stochastic simulations have been chosen as an example of clock operation. The effects of the stochastic fluctuations are quantified by a period histogram and autocorrelation function. The conclusion is that catalytic RNA molecules can act as repressor proteins and simplify the design of genetic oscillators. Second and major contribution: It is demonstrated that a self-activating gene in conjunction with a simple negative interaction can easily produce robust matically validated. This model is comprised of two clearly distinct parts. The first is a positive feedback created by a protein that binds to the promoter of its own gene and activates the transcription. The second is a negative interaction in which a repressor molecule prevents this protein from binding to its promoter. A stochastic study shows that the system is robust to noise. A deterministic study identifies that the oscillator dynamics are mainly driven by two types of biomolecules: the protein, and the complex formed by the repressor and this protein. The main conclusion of this study is that a simple and usual negative interaction, such as degradation, se¬questration or inhibition, acting on the positive transcriptional feedback of a single gene is a sufficient condition to produce reliable oscillations. One gene is enough and the positive transcriptional feedback signal does not need to activate a second repressor gene. At the genetic level, this means that an explicit negative feedback loop is not necessary. Unlike many genetic oscillators, this model needs neither cooperative binding reactions nor the formation of protein multimers. Applications and future research directions: Recently, RNA molecules have been found to play many new catalytic roles. The first oscillatory genetic model proposed in this thesis uses ribozymes as repressor molecules. This could provide new synthetic biology design principles and a better understanding of cel¬lular clocks regulated by RNA molecules. The second genetic model proposed here involves only a repression acting on a self-activating gene and produces robust oscil¬lations. Unlike current two-gene oscillators, this model surprisingly does not require a second repressor gene. This result could help to clarify the design principles of cellular clocks and constitute a new efficient tool for engineering synthetic genetic oscillators. Possible follow-on research directions are: validate models in vivo and in vitro, research the potential of second model as a genetic memory, investigate new genetic oscillators regulated by non-coding RNAs and design a biosensor of positive feedbacks in genetic networks based on the operation of the second model Resumen Introduccion y motivacion: Una amplia variedad de organismos han desarro-llado relojes biomoleculares internos con el fin de adaptarse a los cambios ciclicos del entorno. El funcionamiento de estos relojes involucra redes geneticas. El mo delado de estas redes geneticas es esencial tanto para entender los mecanismos que producen las oscilaciones como para diseiiar nuevos circuitos sinteticos en celulas. Esta tesis doctoral ha dado lugar a dos contribuciones dentro de los campos de los circuitos geneticos en particular, y biologia de sistemas y sintetica en general. La primera contribucion es un nuevo modelo de circuito genetico que muestra un comportamiento oscilatorio usando moleculas de ARN cataliticas. La segunda y principal contribucion es un nuevo modelo de circuito genetico que demuestra que una molecula represora actuando sobre el lazo de un gen auto-activado produce oscilaciones robustas. Primera contribucion: Es un nuevo modelo de oscilador genetico sintetico basado en una tipica red genetica compuesta por dos genes con dos lazos de retroa-limentacion, uno positivo y otro negativo. La novedad de este modelo es que el represor es una molecula de ARN catalftica, en lugar de una protefna o una molecula de ARN no-catalitica. Este ARN catalitico es una ribozima que actua despues de la transcription genetica uniendose y cortando moleculas de ARN mensajero (ARNm). Este reloj genetico involucra solo dos genes, un ARNm y una proteina activadora, aparte de la ribozima. Como ejemplo de funcionamiento, se han escogido valores de los parametros que producen oscilaciones con periodo circadiano (24 horas) tanto en simulaciones deterministas como estocasticas. El efecto de las fluctuaciones es-tocasticas ha sido cuantificado mediante un histograma del periodo y la función de auto-correlacion. La conclusion es que las moleculas de ARN con propiedades cataliticas pueden jugar el misnio papel que las protemas represoras, y por lo tanto, simplificar el diseno de los osciladores geneticos. Segunda y principal contribucion: Es un nuevo modelo de oscilador genetico que demuestra que un gen auto-activado junto con una simple interaction negativa puede producir oscilaciones robustas. Este modelo ha sido estudiado y validado matematicamente. El modelo esta compuesto de dos partes bien diferenciadas. La primera parte es un lazo de retroalimentacion positiva creado por una proteina que se une al promotor de su propio gen activando la transcription. La segunda parte es una interaction negativa en la que una molecula represora evita la union de la proteina con el promotor. Un estudio estocastico muestra que el sistema es robusto al ruido. Un estudio determinista muestra que la dinamica del sistema es debida principalmente a dos tipos de biomoleculas: la proteina, y el complejo formado por el represor y esta proteina. La conclusion principal de este estudio es que una simple y usual interaction negativa, tal como una degradation, un secuestro o una inhibition, actuando sobre el lazo de retroalimentacion positiva de un solo gen es una condition suficiente para producir oscilaciones robustas. Un gen es suficiente y el lazo de retroalimentacion positiva no necesita activar a un segundo gen represor, tal y como ocurre en los relojes actuales con dos genes. Esto significa que a nivel genetico un lazo de retroalimentacion negativa no es necesario de forma explicita. Ademas, este modelo no necesita reacciones cooperativas ni la formation de multimeros proteicos, al contrario que en muchos osciladores geneticos. Aplicaciones y futuras lineas de investigacion: En los liltimos anos, se han descubierto muchas moleculas de ARN con capacidad catalitica. El primer modelo de oscilador genetico propuesto en esta tesis usa ribozimas como moleculas repre¬soras. Esto podria proporcionar nuevos principios de diseno en biologia sintetica y una mejor comprension de los relojes celulares regulados por moleculas de ARN. El segundo modelo de oscilador genetico propuesto aqui involucra solo una represion actuando sobre un gen auto-activado y produce oscilaciones robustas. Sorprendente-mente, un segundo gen represor no es necesario al contrario que en los bien conocidos osciladores con dos genes. Este resultado podria ayudar a clarificar los principios de diseno de los relojes celulares naturales y constituir una nueva y eficiente he-rramienta para crear osciladores geneticos sinteticos. Algunas de las futuras lineas de investigation abiertas tras esta tesis son: (1) la validation in vivo e in vitro de ambos modelos, (2) el estudio del potential del segundo modelo como circuito base para la construction de una memoria genetica, (3) el estudio de nuevos osciladores geneticos regulados por ARN no codificante y, por ultimo, (4) el rediseno del se¬gundo modelo de oscilador genetico para su uso como biosensor capaz de detectar genes auto-activados en redes geneticas.

The effects of cocaine self-administration on dendritic spine density in the rat hippocampus are dependent on genetic background

Chronic exposure to cocaine induces modifications to neurons in the brain regions involved in addiction. Hence, we evaluated cocaine-induced changes in the hippocampal CA1 field in Fischer 344 (F344) and Lewis (LEW) rats, 2 strains that have been widely used to study genetic predisposition to drug addiction, by combining intracellular Lucifer yellow injection with confocal microscopy reconstruction of labeled neurons. Specifically, we examined the effects of cocaine self-administration on the structure, size, and branching complexity of the apical dendrites of CA1 pyramidal neurons. In addition, we quantified spine density in the collaterals of the apical dendritic arbors of these neurons. We found differences between these strains in several morphological parameters. For example, CA1 apical dendrites were more branched and complex in LEW than in F344 rats, while the spine density in the collateral dendrites of the apical dendritic arbors was greater in F344 rats. Interestingly, cocaine self-administration in LEW rats augmented the spine density, an effect that was not observed in the F344 strain. These results reveal significant structural differences in CA1 pyramidal cells between these strains and indicate that cocaine self-administration has a distinct effect on neuron morphology in the hippocampus of rats with different genetic backgrounds.

Identification of thyroid hormone response elements in the human fatty acid synthase promoter

To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.

A genetic method for dissecting the mechanism of transcriptional activator synergy by identical activators

Pairs of transcriptional activators in prokaryotes have been shown to activate transcription synergistically from promoters with two activator binding sites. In some cases, such synergistic effects result from cooperative binding, but in other cases each DNA-bound activator plays a direct role in the activation process by interacting simultaneously with separate surfaces of RNA polymerase. In such cases, each DNA-bound activator must possess a functional activating region, the surface that mediates the interaction with RNA polymerase. When transcriptional activation depends on two or more identical activators, it is not straightforward to test the requirement of each activator for a functional activating region. Here we describe a method for directing a mutationally altered activator to either one or the other binding site, and we demonstrate the use of this method to examine the mechanism of transcriptional activator synergy by the Escherichia coli cyclic AMP receptor protein (CRP) working at an artificial promoter bearing two CRP-binding sites.

Transcription initiation is controlled by three core promoter elements in the hgl5 gene of the protozoan parasite Entamoeba histolytica

Entamoeba histolytica is a single cell eukaryote that is the etiologic agent of amoebic colitis. Core promoter elements of E. histolytica protein encoding genes include a TATA-like sequence (GTATTTAAAG/C) at −30, a novel element designated GAAC (GAACT) that has a variable location between TATA and the site of transcription initiation, and a putative initiator (Inr) element (AAAAATTCA) overlying the site of transcription initiation. The presence of three separate conserved sequences in a eukaryotic core promoter is unprecedented and prompted examination of their roles in regulating transcription initiation. Alterations of all three regions in the hgl5 gene decreased reporter gene activity with the greatest effect seen by mutation of the GAAC element. Positional analysis of the TATA box demonstrated that transcription initiated consistently 30–31 bases downstream of the TATA region. Mutation of either the TATA or GAAC elements resulted in the appearance of new transcription start sites upstream of +1 in the promoter of the hgl5 gene. Mutation of the Inr element resulted in no change in the site of transcription initiation; however, in the presence of a mutated TATA and GAAC regions, the Inr element controlled the site of transcription initiation. We conclude that all three elements play a role in determining the site of transcription initiation. The variable position of the GAAC element relative to the site of transcription initiation, and the multiple transcription initiations that resulted from its mutation, indicate that the GAAC element has an important and apparently novel role in transcriptional control in E. histolytica.

Genetic ablation of root cap cells in Arabidopsis

The root cap is increasingly appreciated as a complex and dynamic plant organ. Root caps sense and transmit environmental signals, synthesize and secrete small molecules and macromolecules, and in some species shed metabolically active cells. However, it is not known whether root caps are essential for normal shoot and root development. We report the identification of a root cap-specific promoter and describe its use to genetically ablate root caps by directing root cap-specific expression of a diphtheria toxin A-chain gene. Transgenic toxin-expressing plants are viable and have normal aerial parts but agravitropic roots, implying loss of root cap function. Several cell layers are missing from the transgenic root caps, and the remaining cells are abnormal. Although the radial organization of the roots is normal in toxin-expressing plants, the root tips have fewer cytoplasmically dense cells than do wild-type root tips, suggesting that root meristematic activity is lower in transgenic than in wild-type plants. The roots of transgenic plants have more lateral roots and these are, in turn, more highly branched than those of wild-type plants. Thus, root cap ablation alters root architecture both by inhibiting root meristematic activity and by stimulating lateral root initiation. These observations imply that the root caps contain essential components of the signaling system that determines root architecture.

Characterization of the α1B-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle

We previously demonstrated that α1B-adrenergic receptor (AR) gene transcription, mRNA, and functionally coupled receptors increase during 3% O2 exposure in aorta, but not in vena cava smooth muscle cells (SMC). We report here that α1BAR mRNA also increases during hypoxia in liver and lung, but not heart and kidney. A single 2.7-kb α1BAR mRNA was detected in aorta and vena cava during normoxia and hypoxia. The α1BAR 5′ flanking region was sequenced to −2,460 (relative to ATG +1). Transient transfection experiments identify the minimal promoter region between −270 and −143 and sequence between −270 and −248 that are required for transcription of the α1BAR gene in aorta and vena cava SMC during normoxia and hypoxia. An ATTAAA motif within this sequence specifically binds aorta, vena cava, and DDT1MF-2 nuclear proteins, and transcription primarily initiates downstream of this motif at approximately −160 in aorta SMC. Sequence between −837 and −273 conferred strong hypoxic induction of transcription in aorta, but not in vena cava SMC, whereas the cis-element for the transcription factor, hypoxia-inducible factor 1, conferred hypoxia-induced transcription in both aorta and vena cava SMC. These data identify sequence required for transcription of the α1BAR gene in vascular SMC and suggest the atypical TATA-box, ATTAAA, may mediate this transcription. Hypoxia-sensitive regions of the α1BAR gene also were identified that may confer the differential hypoxic increase in α1BAR gene transcription in aorta, but not in vena cava SMC.

Induction of minisatellite mutation in NIH 3T3 cells by treatment with the tumor promoter okadaic acid

Okadaic acid (OA) is a strong tumor promoter of mouse skin carcinogenesis and also a potent inhibitor of serine/threonine protein phosphatases. OA induces various genetic alterations in cultured cells, such as diphtheria-toxin-resistance mutations, sister chromatid exchange, exclusion of exogenous transforming oncogenes, and gene amplification. The present study revealed that it caused minisatellite mutation (MSM) at a high frequency in NIH 3T3 cells, although no microsatellite mutation was found. Nine of 31 clones (29%) exhibited MSM after 6 days of OA treatment, as opposed to only 1 of 30 clones (3%) without OA exposure. Moreover, NIH 3T3 cells treated with OA acquired tumorigenicity in nude mice, giving rise to 7 tumors within 25 weeks in 20 sites where 3 × 106 cells were injected. In contrast, the same numbers of untreated cells gave rise to only one tumor, and the tumor grew much slower. All of three OA-induced tumors examined manifested the MSM. The findings thus point to a molecular mechanism by which OA could function as a tumor promoter, and also the biological relevance of the induction of MSM in the tumorigenic process by OA.

Lactone-ring-cleaving enzyme: Genetic analysis, novel RNA editing, and evolutionary implications

A lactonohydrolase from Fusarium oxysporum AKU 3702 is an enzyme catalyzing the hydrolysis of aldonate lactones to the corresponding aldonic acids. The amino acid sequences of the NH2 terminus and internal peptide fragments of the enzyme were determined to prepare synthetic oligonucleotides as primers for the PCR. An approximate 1,000-base genomic DNA fragment thus amplified was used as the probe to clone both genomic DNA and cDNA for the enzyme. The lactonohydrolase genomic gene consists of six exons separated by five short introns. A novel type of RNA editing, in which lactonohydrolase mRNA included the insertion of guanosine and cytidine residues, was observed. The predicted amino acid sequence of the cloned lactonohydrolase cDNA showed significant similarity to those of the gluconolactonase from Zymomonas mobilis, and paraoxonases from human and rabbit, forming a unique superfamily consisting of C-O cleaving enzymes and P-O cleaving enzymes. Lactonohydrolase was expressed under the control of the lac promoter in Escherichia coli.

Gilbert syndrome and glucose-6-phosphate dehydrogenase deficiency: A dose-dependent genetic interaction crucial to neonatal hyperbilirubinemia

Severe jaundice leading to kernicterus or death in the newborn is the most devastating consequence of glucose-6-phosphate dehydrogenase (EC 1.1.1.49; G-6-PD) deficiency. We asked whether the TA repeat promoter polymorphism in the gene for uridinediphosphoglucuronate glucuronosyltransferase 1 (EC 2.4.1.17; UDPGT1), associated with benign jaundice in adults (Gilbert syndrome), increases the incidence of neonatal hyperbilirubinemia in G-6-PD deficiency. DNA from term neonates was analyzed for UDPGT1 polymorphism (normal homozygotes, heterozygotes, variant homozygotes), and for G-6-PD Mediterranean deficiency. The variant UDPGT1 promoter allele frequency was similar in G-6-PD-deficient and normal neonates. Thirty (22.9%) G-6-PD deficient neonates developed serum total bilirubin ≥ 257 μmol/liter, vs. 22 (9.2%) normals (P = 0.0005). Of those with the normal homozygous UDPGT1 genotype, the incidence of hyperbilirubinemia was similar in G-6-PD-deficients and controls (9.7% and 9.9%). In contrast, in the G-6-PD-deficient neonates, those with the heterozygous or homozygous variant UDPGT1 genotype had a higher incidence of hyperbilirubinemia than corresponding controls (heterozygotes: 31.6% vs. 6.7%, P < 0.0001; variant homozygotes: 50% vs. 14.7%, P = 0.02). Among G-6-PD-deficient infants the incidence of hyperbilirubinemia was greater in those with the heterozygous (31.6%, P = 0.006) or variant homozygous (50%, P = 0.003) UDPGT1 genotype than in normal homozygotes. In contrast, among those normal for G-6-PD, the UDPGT1 polymorphism had no significant effect (heterozygotes: 6.7%; variant homozygotes: 14.7%). Thus, neither G-6-PD deficiency nor the variant UDPGT1 promoter, alone, increased the incidence of hyperbilirubinemia, but both in combination did. This gene interaction may serve as a paradigm of the interaction of benign genetic polymorphisms in the causation of disease.

Differentially expressed protein Pdcd4 inhibits tumor promoter-induced neoplastic transformation

An mRNA differential display comparison of mouse JB6 promotion-sensitive (P+) and -resistant (P−) cells identified a novel gene product that inhibits neoplastic transformation. The JB6 P+ and P− cells are genetic variants that differ in their transformation response to tumor promoters; P+ cells form anchorage-independent colonies that are tumorigenic, and P− cells do not. A differentially displayed fragment, A7-1, was preferentially expressed in P− cells at levels ≥10-fold those in P+ cells, making its mRNA a candidate inhibitor of neoplastic transformation. An A7-1 cDNA was isolated that was identical to murine Pdcd4 gene cDNAs, also known as MA-3 or TIS, and analogous to human H731 and 197/15a. Until now, the function of the Pdcd4 protein has been unknown. Paralleling the mRNA levels, Pdcd4 protein levels were greater in P− than in P+ cells. Pdcd4 mRNA was also expressed at greater levels in the less progressed keratinocytes of another mouse skin neoplastic progression series. To test the hypothesis that Pdcd4 inhibits tumor promoter-induced transformation, stable cell lines expressing antisense Pdcd4 were generated from parental P− cells. The reduction of Pdcd4 proteins in antisense lines was accompanied by acquisition of a transformation-sensitive (P+) phenotype. The antisense-transfected cells were reverted to their initial P− phenotype by overexpression of a Pdcd4 sense fragment. These observations demonstrate that the Pdcd4 protein inhibits neoplastic transformation.