Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Ground truthing the Cd/Ca-carbon isotope relationship in foraminifera of the Greenland-Iceland-Norwegian Seas

In order to examine whether the paleoceanographic nutrient proxies, d13C and cadmium/calcium in foraminiferal calcite, are well coupled to nutrients in the region of North Atlantic Deep Water formation, we present da ta from two transects of the Greenland-Iceland-Norwegian Seas. Along Transect A (74.3°N, 18.3°E to 75.0°N, 12.5°W, 15 stations), we measured phosphate and Cd concentrations of modern surface sea water. Along Transect B (64.5°N, 0.7°W to 70.4°N, 18.2°W, 14 stations) we measured Cd/Ca ratios and d13C of the planktonic foraminifera Neogloboquadrina pachyderma sinistral in core top sediments. Our results indicate that Cd and phosphate both vary with surface water mass and are well correlated along Transect A. Our planktonic foraminiferal d13C data indicate similar nutrient variation with water mass along Transect B. Our Cd/Ca data hint at the same type of nutrient variability, but interpretations are hampered by low values close to the detection limit of this technique and therefore relatively large error bars. We also measured Cd and phosphate concentrations in water depth profiles at three sites along Transect A and the d13C of the benthic foraminifera Cibicidoides wuellerstorfi along Transect B. Modern sea water depth profiles along Transect A have nutrient depletions at the surface and then constant values at depths greater than 100 meters. The d13C of planktonic and benthic foraminifera from Transect B plotted versus depth also reflect surface nutrient depletion and deep nutrient enrichment as seen at Transect A, with a small difference between intermediate and deep waters. Overall we see no evidence for decoupling of Cd/Ca ratio and d13C in foraminiferal calcite from water column nutrient concentrations along these transects in a region of North Atlantic Deep Water formation.

Planktonic foraminifera of the Mediterranean Sea

A high-resolution biochronology is presented for the Late Quaternary of the central Mediterranean. In the Late Pleistocene-Holocene successions three assemblage zones are distinguished on the basis of frequency patterns of planktic foraminifera. The age of these zones is determined by Accelerator Mass Spectrometry (AMS)14C dating. The zonal boundaries are dated at 12,700 yr B.P. (the end of Termination Ia) and 9600 yr B.P. (the start of Termination Ib), respectively. The AMS dates show that major changes in the planktic and benthic realms occurred synchronously over wide areas, although records of individual species may show important regional differences. In the studied areas, resedimentation processes revealed by anomalous successions of14C dates, play a far more important role than indicated by the sedimentological and micropaleontological data. Possibly these processes contribute to the very high accumulation rates in the glacial Zone III. Although the AMS technique has increased the accuracy of14C-measurements, admixture of older carbonate may still lead to substantial age differences between areas with different sedimentary regimes.

Benthic foraminiferal fauna and isotope record in Holocene sediments of the northwest Indian Ocean

Historically, the Holocene has been considered an interval of relatively stable climate. However, recent studies from the northern Arabian Sea (Netherlands Indian Ocean Program 905) suggested high-amplitude climate shifts in the early and middle Holocene based on faunal and benthic isotopic proxy records. We examined benthic foraminiferal faunal and stable isotopic data from Ocean Drilling Program (ODP) Site 723 and total organic carbon data from ODP Site 724, Oman Margin (808 and 593 m water depths, respectively). At Site 723 the mid-Holocene shift in d18O values of infaunal benthic species Uvigerina peregrina (1.4 per mil) is 3 times larger than that of epifaunal benthic species Cibicides kullenbergi recorded at Site NIOP 905 off Somalia. However, none of the five other benthic species we measured at Hole 723A exhibits such a shift in d18O. We speculate that the late Holocene d18O decrease in U. peregrina represents species-specific changes in ecological habitat or food preference in response to changes in surface and deep ocean circulation. While the stable isotopic data do not appear to indicate a middle Holocene climatic shift, our total organic carbon and benthic faunal assemblage data do indicate that the early Holocene deep Arabian Sea was influenced by increased ventilation perhaps by North Atlantic Deep Water and/or Circumpolar Deep Water incursions into the Indian Ocean, leading to remineralization of organic matter and a relatively weak early Holocene oxygen minimum zone in the northwest Arabian Sea in spite of strong summer monsoon circulation.

Dissolved phosphorus in soil solution of the Jena Experiment (Main Experiment, year 2003)

This data set contains measurements of dissolved phosphorus (total dissolved nitrogen: TDP, dissolved inorganic phosphorus: PO4P and dissolved organic phosphorus: DOP) in samples of soil water collected in 2003 from the main experiment plots of a large grassland biodiversity experiment (the Jena Experiment; see further details below). In the main experiment, 82 grassland plots of 20 x 20 m were established from a pool of 60 species belonging to four functional groups (grasses, legumes, tall and small herbs). In May 2002, varying numbers of plant species from this species pool were sown into the plots to create a gradient of plant species richness (1, 2, 4, 8, 16 and 60 species) and functional richness (1, 2, 3, 4 functional groups). Plots were maintained by bi-annual weeding and mowing. Glass suction plates with a diameter of 12 cm, 1 cm thickness and a pore size of 1-1.6 mm (UMS GmbH, Munich, Germany) were installed in April 2002 in depths of 10, 20, 30 and 60 cm to collect soil solution. Manual soil matric potential measurements were used to regulate the vacuum system. The sampling bottles were continuously evacuated to a negative pressure between 50 and 350 mbar, such that the suction pressure was about 50 mbar above the actual soil water tension. Thus, only the soil leachate was collected. Cumulative soil solution was sampled bi-weekly, in 2003 at the 07.03.2003; 24.03.2003; 07.04.2003; 22.04.2003; 07.05.2003; 20.05.2003; 03.06.2003; 28.07.2003; 12.09.2003; 22.09.2003; 07.10.2003; and 21.10.2003, and analyzed for dissolved inorganic P (PO4P) and total dissolved phosphorus (TDP). Inorganic phosphorus concentrations in the soil solution were measured photometrically with a continuous flow analyzer (CFA SAN++, Skalar [Breda, The Netherlands]). Ammonium molybdate catalyzed by antimony tartrate reacts in an acidic medium with phosphate and forms a phospho-molybdic acid complex. Ascorbic acid reduces this complex to an intensely blue-colored complex. Total dissolved P in soil solution was analyzed by irradiation with UV and oxidation with K2S2O8 followed by reaction with ammonium molybdate (Skalar catnr. 503-553w/r). As the molybdic complex forms under strongly acidic conditions, we could not exclude the hydrolysis of labile organic P compounds in our samples. Furthermore, the molybdate reaction is not sensitive for condensed phosphates. The detection limits of both TDP and PO4P were 0.02 mg P l-1 (CFA, Skalar). Dissolved organic P (DOP) in soil solution was calculated as the difference between TDP and PO4P. In a low number of samples, TDP was equal to or smaller than PO4P; in these cases, DOP was assumed to be zero.

Dissolved phosphorus in soil solution of the Jena Experiment (Main Experiment, year 2004)

This data set contains measurements of dissolved phosphorus (total dissolved nitrogen: TDP, dissolved inorganic phosphorus: PO4P and dissolved organic phosphorus: DOP) in samples of soil water collected in 2004 from the main experiment plots of a large grassland biodiversity experiment (the Jena Experiment; see further details below). In the main experiment, 82 grassland plots of 20 x 20 m were established from a pool of 60 species belonging to four functional groups (grasses, legumes, tall and small herbs). In May 2002, varying numbers of plant species from this species pool were sown into the plots to create a gradient of plant species richness (1, 2, 4, 8, 16 and 60 species) and functional richness (1, 2, 3, 4 functional groups). Plots were maintained by bi-annual weeding and mowing. Glass suction plates with a diameter of 12 cm, 1 cm thickness and a pore size of 1-1.6 µm (UMS GmbH, Munich, Germany) were installed in April 2002 in depths of 10, 20, 30 and 60 cm to collect soil solution. Manual soil matric potential measurements were used to regulate the vacuum system. The sampling bottles were continuously evacuated to a negative pressure between 50 and 350 mbar, such that the suction pressure was about 50 mbar above the actual soil water tension. Thus, only the soil leachate was collected. Cumulative soil solution was sampled bi-weekly, in 2004 at the 15.01.2004; 30.01.2004; 12.02.2004; 27.02.2004; 09.03.2004; 25.03.2004; 21.04.2004; 07.05.2004; and 24.05.2004, and analyzed for dissolved inorganic P (PO4P) and total dissolved phosphorus (TDP). Inorganic phosphorus concentrations in the soil solution were measured photometrically with a continuous flow analyzer (for samples collected until spring 2004: CFA SAN++, Skalar [Breda, The Netherlands]; for samples collected later: CFA Autoanalyzer [Bran&Luebbe, Norderstedt, Germany]). Ammonium molybdate catalyzed by antimony tartrate reacts in an acidic medium with phosphate and forms a phospho-molybdic acid complex. Ascorbic acid reduces this complex to an intensely blue-colored complex. Total dissolved P in soil solution was analyzed by irradiation with UV and oxidation with K2S2O8 followed by reaction with ammonium molybdate (Skalar catnr. 503-553w/r). As the molybdic complex forms under strongly acidic conditions, we could not exclude the hydrolysis of labile organic P compounds in our samples. Furthermore, the molybdate reaction is not sensitive for condensed phosphates. The detection limits of both TDP and PO4P were 0.02 mg P l-1 (CFA, Skalar) and 0.04 mg P l-1 (Autoanalyzer, Bran&Luebbe). Dissolved organic P (DOP) in soil solution was calculated as the difference between TDP and PO4P. In a low number of samples, TDP was equal to or smaller than PO4P; in these cases, DOP was assumed to be zero.

Dissolved nitrogen in soil solution of the Jena Experiment (Main Experiment, year 2004)

This data set contains measurements of dissolved nitrogen (total dissolved nitrogen: TDN, dissolved organic nitrogen: DON, dissolved ammonium: NH4+, and dissolved nitrate: NO3-) in samples of soil water collected from the main experiment plots of a large grassland biodiversity experiment (the Jena Experiment; see further details below). In the main experiment, 82 grassland plots of 20 x 20 m were established from a pool of 60 species belonging to four functional groups (grasses, legumes, tall and small herbs). In May 2002, varying numbers of plant species from this species pool were sown into the plots to create a gradient of plant species richness (1, 2, 4, 8, 16 and 60 species) and functional richness (1, 2, 3, 4 functional groups). Plots were maintained by bi-annual weeding and mowing. In April 2002 glass suction plates with a diameter of 12 cm, 1 cm thickness and a pore size of 1-1.6 µm (UMS GmbH, Munich, Germany) were installed in depths of 10, 20, 30 and 60 cm to collect soil solution. The sampling bottles were continuously evacuated to a negative pressure between 50 and 350 mbar, such that the suction pressure was about 50 mbar above the actual soil water tension. Thus, only the soil leachate was collected. Cumulative soil solution was sampled biweekly and analyzed for nitrate (NO3-) and ammonium (NH4+) concentrations with a continuous flow analyzer (CFA, Skalar, Breda, The Netherlands). Nitrate was analyzed photometrically after reduction to NO2- and reaction with sulfanilamide and naphthylethylenediamine-dihydrochloride to an azo-dye. Our NO3- concentrations contained an unknown contribution of NO2- that is expected to be small. Simultaneously to the NO3- analysis, NH4+ was determined photometrically as 5-aminosalicylate after a modified Berthelot reaction. The detection limits of NO3- and NH4+ were 0.02 and 0.03 mg N L-1, respectively. Total dissolved N in soil solution was analyzed by oxidation with K2S2O8 followed by reduction to NO2- as described above for NO3-. Dissolved organic N (DON) concentrations in soil solution were calculated as the difference between TDN and the sum of mineral N (NO3- + NH4+). In 5% of the samples, TDN was equal to or smaller than mineral N. In these cases, DON was assumed to be zero.

Seasonally aggregated values of dissolved inorganic phosphorus in soil solution of the Jena Experiment (Main Experiment, year 2004)

This data set contains measurements of inorganic phosphorus in samples of soil solution collected in 2004 from the main experiment plots of a large grassland biodiversity experiment (the Jena Experiment; see further details below) that have been aggregated to seasonal values. In the main experiment, 82 grassland plots of 20 x 20 m were established from a pool of 60 species belonging to four functional groups (grasses, legumes, tall and small herbs). In May 2002, varying numbers of plant species from this species pool were sown into the plots to create a gradient of plant species richness (1, 2, 4, 8, 16 and 60 species) and functional richness (1, 2, 3, 4 functional groups). Plots were maintained by bi-annual weeding and mowing. Glass suction plates with a diameter of 12 cm, 1 cm thickness and a pore size of 1-1.6 µm (UMS GmbH, Munich, Germany) were installed in April 2002 in depths of 10, 20, 30 and 60 cm to collect soil solution. Manual soil matric potential measurements were used to regulate the vacuum system. Manual soil matric potential measurements were used to regulate the vacuum system. The sampling bottles were continuously evacuated to a negative pressure between 50 and 350 mbar, such that the suction pressure was about 50 mbar above the actual soil water tension. Thus, only the soil leachate was collected. Cumulative soil solution was sampled biweekly and analyzed for dissolved inorganic P (PO4P). Here volume-weighted mean values are provided as aggregated seasonal values (spring = March to May, summer = June to August, fall = September to November, winter = December to February) for 2004 in spring, fall, and winter. To calculate these values, the sampled volume of soil solution is used as weight for P concentrations of the respective sampling date. Inorganic phosphorus concentrations in the soil solution were measured photometrically with a continuous flow analyzer (for samples collected until spring 2004: CFA SAN++, Skalar [Breda, The Netherlands]; for samples collected later: CFA Autoanalyzer [Bran&Luebbe, Norderstedt, Germany]). Ammonium molybdate catalyzed by antimony tartrate reacts in an acidic medium with phosphate and forms a phospho-molybdic acid complex. Ascorbic acid reduces this complex to an intensely blue-colored complex. As the molybdic complex forms under strongly acidic conditions, we could not exclude the hydrolysis of labile organic P compounds in our samples. Furthermore, the molybdate reaction is not sensitive for condensed phosphates. The detection limits of both TDP and PO4P were 0.02 mg P l-1 (CFA, Skalar) and 0.04 mg P l-1 (Autoanalyzer, Bran&Luebbe).

Magnetic viscosity and paleomagnetism of the basement complex at DSDP Hole 77-538A

The basement at Catoche Knoll consists of Paleozoic gneiss and amphibolite intruded by several generations of early Jurassic diabase dikes. Upon exposure to a 1-oersted field for 9 days, the diabase and amphibolite acquire a viscous remanent magnetization (VRM) which ranges from 42 to 2047% of their natural remanent magnetization (NRM). A magnetic field of similar intensity is observed in the paleomagnetic facility of the Glomar Challenger, and it is therefore doubtful if accurate measurements of magnetic moments in such rocks can be made on board unless the facility is magnetically shielded. The significant VRM also indicates the futility of attempting to discern magnetic lineations from an ocean floor composed of such rocks. No strong correlation exists between the Königsberger ratio, which is usually less than 1, and the tendency to acquire a VRM. The VRM decay is typical of a Richter aftereffect, but the relaxation times vary widely among the samples studied. A stable remanence is observed after alternating field demagnetization to 200 Oe. The range of magnetic inclinations in the diabase dikes is consistent with 40Ar/39Ar dates of 190 and 160 Ma. The inclinations suggest that the Catoche Knoll block tilted more than 20° to the north after the final dike intrusion.

Tab. 2: Gravity measurements of the Inntal underground at Thaur

A cross-section of the Inn-valley has been surveyed by refraction- and refiection-seismic and gravimetrie methods. The thickness of the Inn-va.!ley sediments is 340- 390 m. At the northern edge of the valley an intermediate layer between sediments and basement has been detected, which is up to 300 ITl thick. This zone seems to mark the boundary of the northern calcareous alps.