955 resultados para Glial cell line-derived neurotrophic factor (GDNF)


Relevância:

100.00% 100.00%

Publicador:

Resumo:

High-affinity binding was demonstrated between suppressor-T-cell-derived bioactive glycosylation-inhibiting factor (GIF) and helper T hybridomas and natural killer cell line cells. Inactive GIF present in cytosol of suppressor T cells and Escherichia coli-derived recombinant human GIF (rhGIF) failed to bind to these cells. However, affinity of rhGIF for the target cells was generated by replacement of Cys-57 in the sequence with Ala or of Asn-106 with Ser or binding of 5-thio-2-nitrobenzoic acid to Cys-60 in the molecule. Such mutations and the chemical modification of rhGIF synergistically increased the affinity of GIF molecules for the target cells. The results indicated that receptors on the target cells recognize conformational structures of bioactive GIF. Equilibrium dissociation constant (Kd) of the specific binding between bioactive rGIF derivatives and high-affinity receptors was 10–100 pM. Receptors for bioactive GIF derivatives were detected on Th1 and Th2 T helper clones and natural killer NK1.1+ cells in normal spleen but not on naive T or B cells. Neither the inactive rGIF nor bioactive rGIF derivatives bound to macrophage and monocyte lines or induced macrophages for tumor necrosis factor α production.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Alveolar rhabdomyosarcoma (ARMS) cells often harbor one of two unique chromosomal translocations, either t(2;13)(q35;q14) or t(1;13)(p36;q14). The chimeric proteins expressed from these rearrangements, PAX3-FKHR and PAX7-FKHR, respectively, are potent transcriptional activators. In an effort to exploit these unique cancer-specific molecules to achieve ARMS-specific expression of therapeutic genes, we have studied the expression of a minimal promoter linked to six copies of a PAX3 DNA binding site, prs-9. In transient transfections, expression of the prs-9-regulated reporter genes was ≈250-fold higher than expression of genes lacking the prs-9 sequences in cell lines derived from ARMS, but remained at or below baseline levels in other cells. High expression of these prs-9-regulated genes was also observed in a cancer cell line that lacks t(2;13) but was stably transfected with a plasmid expressing PAX3-FKHR. Transfection of a plasmid containing the diphtheria toxin A chain gene regulated by prs-9 sequences (pA3–6PED) was selectively cytotoxic for PAX3-FKHR-expressing cells. This was shown by inhibition of gene expression from cotransfected plasmids and by direct cytotoxicity after transfected cells were isolated by cell sorting. Gene transfer of pA3–6PED may thus be useful as a cancer-specific treatment strategy for t(2;13)- or t(1;13)-positive ARMS. Furthermore, gene transfer of fusion protein-regulated toxin genes might also be applied to the treatment of other cancers that harbor cancer-specific chromosomal translocations involving transcription factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The type IV collagenases/gelatinases matrix metalloproteinase-2 (MMP-2) and MMP-9 play a variety of important roles in both physiological and pathological processes and are regulated by various growth factors, including transforming growth factor-β1 (TGF-β1), in several cell types. Previous studies have suggested that cellular control of one or both collagenases can occur through direct transcriptional mechanisms and/or after secretion through proenzyme processing and interactions with metalloproteinase inhibitors. Using human prostate cancer cell lines, we have found that TGF-β1 induces the MMP-9 proenzyme; however, this induction does not result from direct effects on gene transcription but, instead, through a protein synthesis–requiring process leading to increased MMP-9 mRNA stability. In addition, we have examined levels of TGF-β1 regulation of MMP-2 in one prostate cancer cell line and found that TGF-β1 induces higher secreted levels of this collagenase through increased stability of the secreted 72-kDa proenzyme. These results identify two novel nontranscriptional pathways for the cellular regulation of MMP-9 and MMP-2 collagenase gene expression and activities.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The β cell-specific glucose-sensitive factor (GSF), which binds the A3 motif of the rat I and human insulin promoters, is modulated by extracellular glucose. A single mutation in the GSF binding site of the human insulin promoter abolishes the stimulation by high glucose only in normal islets, supporting the suggested physiological role of GSF in the glucose-regulated expression of the insulin gene. GSF binding activity was observed in all insulin-producing cells. We have therefore purified this activity from the rat insulinoma RIN and found that a single polypeptide of 45 kDa was responsible for DNA binding. Its amino acid sequence, determined by microsequencing, provided direct evidence that GSF corresponds to insulin promoter factor 1 (IPF-1; also known as PDX-1) and that, in addition to its essential roles in development and differentiation of pancreatic islets and in β cell-specific gene expression, it functions as mediator of the glucose effect on insulin gene transcription in differentiated β cells. The human cDNA coding for GSF/IPF-1 has been cloned, its cell and tissue distribution is described. Its expression in the glucagon-producing cell line αTC1 transactivates the wild-type human insulin promoter more efficiently than the mutated construct. It is demonstrated that high levels of ectopic GSF/IPF-1 inhibit the expression of the human insulin gene in normal islets, but not in transformed βTC1 cells. These results suggest the existence of a control mechanism, such as requirement for a coactivator of GSF/IPF-1, which may be present in limiting amounts in normal as opposed to transformed β cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

CYR61 is a secreted, cysteine-rich, heparin-binding protein encoded by a growth factor-inducible immediate–early gene. Acting as an extracellular, matrix-associated signaling molecule, CYR61 promotes the adhesion of endothelial cells through interaction with the integrin αVβ3 and augments growth factor-induced DNA synthesis in the same cell type. In this study, we show that purified CYR61 stimulates directed migration of human microvascular endothelial cells in culture through an αVβ3-dependent pathway and induces neovascularization in rat corneas. Both the chemotactic and angiogenic activities of CYR61 can be blocked by specific anti-CYR61 antibodies. Whereas most human tumor-derived cell lines tested express CYR61, the gastric adenocarcinoma cell line RF-1 does not. Expression of the CYR61 cDNA under the regulation of a constitutive promoter in RF-1 cells significantly enhances the tumorigenicity of these cells as measured by growth in immunodeficient mice, resulting in tumors that are larger and more vascularized than those produced by control RF-1 cells. Taken together, these results identify CYR61 as an angiogenic inducer that can promote tumor growth and vascularization; the results also suggest potential roles for CYR61 in physiologic and pathologic neovascularization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Vascular endothelial growth factor (VEGF) is a hypoxia-inducible angiogenic peptide with recently identified neurotrophic effects. Because some neurotrophic factors can protect neurons from hypoxic or ischemic injury, we investigated the possibility that VEGF has similar neuroprotective properties. In HN33, an immortalized hippocampal neuronal cell line, VEGF reduced cell death associated with an in vitro model of cerebral ischemia: at a maximally effective concentration of 50 ng/ml, VEGF approximately doubled the number of cells surviving after 24 h of hypoxia and glucose deprivation. To investigate the mechanism of neuroprotection by VEGF, the expression of known target receptors for VEGF was measured by Western blotting, which showed that HN33 cells expressed VEGFR-2 receptors and neuropilin-1, but not VEGFR-1 receptors. The neuropilin-1 ligand placenta growth factor-2 failed to reproduce the protective effect of VEGF, pointing to VEGFR-2 as the site of VEGF's neuroprotective action. Two phosphatidylinositol 3′-kinase inhibitors, wortmannin and LY294002, reversed the neuroprotective effect of VEGF, implicating the phosphatidylinositol 3′-kinase/Akt signal transduction system in VEGF-mediated neuroprotection. VEGF also protected primary cultures of rat cerebral cortical neurons from hypoxia and glucose deprivation. We conclude that in addition to its known role as an angiogenic factor, VEGF may exert a direct neuroprotective effect in hypoxic-ischemic injury.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In vivo all-trans-retinoic acid (ATRA), a differentiation inducer, is capable of causing clinical remission in about 90% of patients with acute promyelocytic leukemia (APL). The molecular basis for the differentiation of APL cells after treatment with ATRA remains obscure and may involve genes other than the known retinoid nuclear transcription factors. We report here the ATRA-induced gene expression in a cell line (NB4) derived from a patient with APL. By differential display-PCR, we isolated and characterized a novel gene (RIG-E) whose expression is up-regulated by ATRA. The gene is 4.0 kb long, consisting of four exons and three introns, and is localized on human chromosome region 8q24. The deduced amino acid sequence predicts a cell surface protein containing 20 amino acids at the N-terminal end corresponding to a signal peptide and an extracellular sequence containing 111 amino acids. The RIG-E coded protein shares some homology with CD59 and with a number of growth factor receptors. It shares high sequence homology with the murine LY-6 multigene family, whose members are small cysteine-rich proteins differentially expressed in several hematopoietic cell lines and appear to function in signal transduction. It seems that so far RIG-E is the closest human homolog of the LY-6 family. Expression of RIG-E is not restricted to myeloid differentiation, because it is also present in thymocytes and in a number of other tissues at different levels.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cytotoxic lymphocytes are characterized by their inclusion of cytoplasmic granules that fuse with the plasma membrane following target cell recognition. We previously identified a cytotoxic granule membrane protein designated p15-TIA-1 that is immunochemically related to an RNA-recognition motif (RRM)-type RNA-binding protein designated p40-TIA-1. Although it was suggested that p15-TIA-1 might be derived from p40-T1A-1 by proteolysis, N-terminal amino acid sequencing of p15-TIA-1 immunoaffinity purified from a natural killer (NK) cell line by using monoclonal antibody (mAb) 2G9 revealed that p15-T1A-1 is identical to the deduced amino acid sequence of NKG7 and GIG-1, cDNAs isolated from NK cells and granulocyte-colony-stimulating factor-treated mononuclear cells, respectively. Epitope mapping revealed that mAb 2G9 recognizes the C terminus of p15-T1A-1 and p40-T1A-1. The deduced amino acid sequence of p15-T1A-1/NKG7/GIG-1 predicts that the protein possesses four transmembrane domains, and immuno-electron microscopy localizes the endogenous protein to the membranes of cytotoxic granules in NK cells. Given its subcellular localization, we propose to rename-this protein GMP-17, for granule membrane protein of 17 kDa. Immunofluorescence microscopy of freshly isolated NK cells confirms this granular localization. Target cell-induced NK cell degranulation results in translocation of GMP-17 from granules to the plasma membrane, suggesting a possible role for GMP-17 in regulating the effector function of lymphocytes and neutrophils.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A detailed structure-function analysis of human interleukin 5 (hIL5) has been performed. The hIL5 receptor is composed of two different polypeptide chains, the alpha and beta subunits. The alpha subunit alone is sufficient for ligand binding, but association with the beta subunit leads to a 2- to 3-fold increase in binding affinity. The beta chain is shared with the receptors for IL3 and granulocyte/macrophage-colony-stimulating factor--hence the descriptor beta C (C for common). All hIL5 mutants were analyzed in a solid-phase binding assay for hIL5R alpha interaction and in a proliferation assay using IL5-dependent cell lines for receptor-complex activation. Most residues affecting binding to the receptor alpha subunit were clustered in a loop connecting beta-strand 1 and helix B (mutants H38A, K39A, and H41A), in beta-strand 2 (E89A and R91A; weaker effect for E90A) and close to the C terminus (T109A, E110A, W111S, and I112A). Mutations at one position, E13 (Glu13), caused a reduced activation of the hIL5 receptor complex. In the case of E13Q, only 0.05% bioactivity was detected on a hIL5-responsive subclone of the mouse promyelocytic cell line FDC-P1. Moreover, on hIL5-responsive TF1 cells, the same mutant was completely inactive and proved to have antagonistic properties. Interactions of this mutant with both receptor subunits were nevertheless indistinguishable from those of nonmutated hIL5 by crosslinking and Scatchard plot analysis of transfected COS-1 cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Distinct glial cell types of the vertebrate peripheral nervous system (PNS) are derived from the neural crest. Here we show that the expression of the Ets domain transcription factor Erm distinguishes satellite glia from Schwann cells beginning early in rat PNS development. In developing dorsal root ganglia (DRG), Erm is present both in presumptive satellite glia and in neurons. In contrast, Erm is not detectable at any developmental stage in Schwann cells in peripheral nerves. In addition, Erm is downregulated in DRG-derived glia adopting Schwann cell traits in culture. Thus, Erm is the first described transcription factor expressed in satellite glia but not in Schwann cells. In culture, the Neuregulin1 (NRG1) isoform GGF2 maintains Erm expression in presumptive satellite cells and reinduces Erm expression in DRG-derived glia but not in Schwann cells from sciatic nerve. These data demonstrate that there are intrinsic differences between these glial subtypes in their response to NRG1 signaling. In neural crest cultures, Erm-positive progenitor cells give rise to two distinct glial subtypes: Erm-positive, Oct-6-negative satellite glia in response to GGF2, and Erm-negative, Oct-6-positive Schwann cells in the presence of serum and the adenylate cyclase activator forskolin. Thus, Erm-positive neural crest-derived progenitor cells and presumptive satellite glia are able to acquire Schwann cell features. Given the in vivo expression of Erm in peripheral ganglia, we suggest that ganglionic Erm-positive cells may be precursors of Schwann cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The ciliary neurotrophic factor alpha-receptor(CNTFRalpha) is required for motoneuron survival during development, but the relevant ligand(s) has not been determined. One candidate is the heterodimer formed by cardiotrophin-like cytokine (CLC) and cytokine-like factor 1 (CLF). CLC/CLF binds to CNTFRalpha and enhances the survival of developing motoneurons in vitro; whether this novel trophic factor plays a role in neural development in vivo has not been tested. We examined motor and sensory neurons in embryonic chicks treated with CLC and in mice with a targeted deletion of the clf gene. Treatment with CLC increased the number of lumbar spinal cord motoneurons that survived the cell death period in chicks. However, this effect was regionally specific, because brachial and thoracic motoneurons were unaffected. Similarly, newborn clf -/- mice exhibited a significant reduction in lumbar motoneurons, with no change in the brachial or thoracic cord. Clf deletion also affected brainstem motor nuclei in a regionally specific manner; the number of motoneurons in the facial but not hypoglossal nucleus was significantly reduced. Sensory neurons of the dorsal root ganglia were not affected by either CLC treatment or clf gene deletion. Finally, mRNA for both clc and clf was found in skeletal muscle fibers of embryonic mice during the motoneuron cell death period. These findings support the view that CLC/CLF is a target-derived factor required for the survival of specific pools of motoneurons. The in vivo actions of CLC and CLF can account for many of the effects of CNTFRalpha on developing motoneurons.