768 resultados para Equino - Sêmen
Resumo:
Pós-graduação em Aquicultura - FCAV
Resumo:
Records from 14,288 animals of the Mangalarga Marchador breed, born from 1990 to 2005, were used to discard morphofunctional traits in a principal component analysis. The following traits were used: height at withers, height at croup, lengths of head, neck, back, croup, hip length and body, widths of head, hip width, thorax perimeter, cannon bone circumference and gait score. For the traits considered it was observed that 7 principal components showed variation lower than 0.7; suggesting that seven variables could be discarded. The reason is that when variable are highly correlated with the principal components of smaller variance, their variation is practically insignificant. Based on those results the recommendation is to maintain the following traits for future research with this database: gait score, height at croup, length of back, length of croup, width of head and cannon bone circumference.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Avaliou-se a resposta de fase aguda através da concentração das proteínas de fase aguda (PFA) no soro sanguíneo e no líquido peritoneal de vinte e um equinos, hígidos e submetidos à obstrução intestinal experimental, distribuídos em quatro grupos: obstrução de duodeno - GD (n=6), íleo - GI (n=6), cólon dorsal esquerdo - GM (n=6) e controle instrumentado - GC (n=3). Foram colhidas amostras de sangue e líquido peritoneal e, após centrifugação e fracionamento, as proteínas de fase aguda foram separadas por eletroforese em SDS-PAGE. Identificaram-se as proteínas IgA, ceruloplasmina, transferrina, albumina, IgG, haptoglobina, α1-glicoproteína ácida e P24, no soro e no líquido peritoneal. Houve aumento nas concentrações sérica e peritoneal de todas as PFA, sendo mais evidente no líquido peritoneal e nos animais obstruídos. O fracionamento eletroforético das PFA no líquido peritoneal é mais eficaz no diagnóstico de processos inflamatórios abdominais, quando comparado ao sérico.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The objective of this study was to evaluate the supplementation of linseed as an omega-3 fatty acid supplier on the functional capacity of jumping horses. 6 horses disposed in two 3 x 3 balanced Latin squares were used. The treatments consisted of increasing levels of linseed mixed with flour and linseed oil in a ratio of 75:25, respectively, resulting in 0g (control), 60g and 120g on a daily basis per horse. The horses were supplemented for 30 days. Physical activity was jumping at riding class level. The functional parameters measured were lameness index, stride length and joint metacarpophalangeal (MCP) biometry (circumference and flexion angle). A significant linseed supplementation effect for doses of 60 and 120g was observed on the lameness index. Feeding 120g of linseed increased stride length while trotting (P<0.05). An increment of 0.5cm on MCP circumference was found in horses that received the control diet when compared to those horses that consumed 120g of linseed. Thus, supplementation of jumping horses with 120g/day of linseed promoted greater stride length at a trot and reduced swelling in the metacarpophalangeal joint, improving their functional capabilities.
Resumo:
Pós-graduação em Aquicultura - FCAV
Resumo:
Pós-graduação em Cirurgia Veterinária - FCAV
Resumo:
Pós-graduação em Genética e Melhoramento Animal - FCAV
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ