975 resultados para Cavalry horses
Resumo:
Summary: Crusting dermatosis in horses caused by Dermatophilus congolensis - a case report
Resumo:
Summary: Carpal canal syndrome in horses : a review of the literature and examples of clinical cases
Resumo:
Neuronal subpopulations of dorsal root ganglion (DRG) cells in the chicken exhibit carbonic anhydrase (CA) activity. To determine whether CA activity is expressed by DRG cells maintained in in vitro cultures, dissociated DRG cells from 10-day-old chick embryos were cultured on a collagen substrate. The influence exerted by environmental factors on the enzyme expression was tested under various conditions of culture. Neuron-enriched cell cultures and mixed DRG-cell cultures (including numerous non-neuronal cells) were performed either in a defined medium or in a horse serum-supplemented medium. In all the tested conditions, subpopulations of cultured sensory neurons expressed CA activity in their cell bodies, while their neurites were rarely stained; in each case, the percentage of CA-positive neurons declined with the age of the cultures. The number and the persistence of neurons possessing CA activity as well as the intensity of the reaction were enhanced by addition of horse serum. In contrast, the expression of the neuronal CA activity was not affected by the presence of non-neuronal cells or by the rise of CO2 concentration. Thus, the appearance and disappearance of neuronal subpopulations expressing CA activity may be decisively influenced by factors contained in the horse serum. The loss of CA-positive neurons with time could result from a cell selection or from genetic repression. Analysis of the time curves does not support a preferential cell death of CA-positive neurons but suggests that the eventual conversion of CA-positive neurons into CA-negative neurons results from a loss of the enzyme activity. These results indicate that the phenotypic expression of cultured sensory neurons is dependent on defined environmental factors.
Resumo:
Primary sensory neurons were grown under four conditions of culture. The influence of nonneuronal cells, horse serum or both was studied on the phenotypic expression of certain neuronal subpopulations. The number of neurons expressing acetylcholinesterase, alpha-bungarotoxin-binding sites or a high uptake capacity for glutamine was enhanced by nonneuronal cells. The horse serum increases the neuronal subpopulation exhibiting a carbonic anhydrase activity. Certain phenotypic changes fit conditions consistent with an epigenetic induction rather than a cell selection.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Summary: Hospital acquired salmonella infections in horses
Resumo:
The free form of the secretory component usually associated with secretory IgA can be isolated from human and bovine milk. These free secretory components of different origin combine in vitro with human polymeric myeloma IgA, with mouse myeloma IgA, and with the serum IgA of nine different mammalian species.
Resumo:
Summary: Occurence of clostridia and Clostridium perfringens in the faecal samples of healthy horses during indoor and outdoor feeding seasons : comparison of methods
Resumo:
The reproductive efficiency of stabled domestic stallions is often lower than what could be expected from observations in feral herds. In the wild, stallions typically live with mares in harem bands, with other stallions in bachelor bands, or occasionally in mixed-sex transitional bands. We, therefore, argue that permanent contact with mares may increase reproductive efficiency of stallions suffering from low libido and/or fertility. We also provide a summary of our present knowledge of natural conditions, management, and husbandry of domestic stallions, and of intra- and intersexual behavioral interactions in horses.
Resumo:
La mediación educativa razonada mediante la interacción con el caballo facilita una nueva forma de aprendizaje, basada en el desarrollo integral de la persona; partiendo de sus capacidades y transformándolas en competencias. Presentamos el Trabajo Reconducido Con Caballos (TRCC) como un espacio natural para potenciar y desarrollar distintas habilidades personales, sociales, cognitivas y físico-motoras, con el fin de lograr competencias que puedan aportar el pleno ajuste social desde la realidad personal de cada educando. Los canales comunicativos, la actitud para afrontar la realidad del entorno de forma positiva, activa y creativa, los comportamientos pasivos o de dependencia que se manifiestan en esta situación, las cualidades coordinativas necesarias para reorganizar el conocimiento del esquema corporal y las experiencias perceptivas, junto con los movimientos del caballo, aglutinan expectativas interesantes que podemos proponernos gracias al TRCC.
Resumo:
La mediació educativa raonada mitjançant la interacció amb el cavall facilita una nova forma d’aprenentatge, basada en el desenvolupament integral de la persona; partint de les seves capacitats i transformant-les en competències. Presentem el Treball Reconduït Amb Cavalls (TRAC) com un espai natural per potenciar i desenvolupar diferents habilitats personals, socials, cognitives i fisicomotrius, per tal d’aconseguir competències que puguin aportar un ajust social complet des de la realitat personal de cada educand. Els canals comunicatius, l’actitud per afrontar la realitat de l’entorn de forma positiva, activa i creativa, els comportaments passius o de dependència que es manifesten en aquesta situació, les qualitats coordinatives necessàries per reorganitzar el coneixement de l’esquema corporal i les experiències perceptives, unides als moviments del cavall, aglutinen expectatives interessants que podem proposar-nos gràcies al TRAC.
Resumo:
We report a case of an outbreak of inflammatory dermatophytoses caused by Arthroderma vanbreuseghemii (formally Trichophyton mentagrophytes pro parte) that involved an infected horse, the owner and at least 20 students, staff and stablemen at a veterinary school in Bern (Switzerland) that presented highly inflammatory dermatitis of the body and the face. Transmission from human to human was also recorded as one patient was the partner of an infected person. Both the phenotypic characteristics and ITS sequence of the dermatophytes isolated from the horse and patients were identical, consistent with the conclusion that the fungus originated from the horse. Three infected persons had not been in direct contact with the horse. Although direct transmission from human to human cannot be ruled out, fomites were most likely the source of infection for these three patients. Inspection of the literature at the end of the nineteenth and beginning of the twentieth century revealed that this dermatophyte was frequently transmitted from horses to humans in contact with horses (stablemen, coachmen, carters and artillery soldiers). The rarity of the present case report at the present time is likely related to the transformation of civilisation from the nineteenth century to nowadays in Europe with the change of horse husbandry. In addition, the inadequate immune response of the horse and the high number of people in contact with it at the equine clinic may explain the exceptional aspect of this case report.
Resumo:
Odours of vertebrates often contain information about the major histocompatibility complex (MHC), and are used in kin recognition, mate choice or female investment in pregnancy. It is, however, still unclear whether MHC-linked signals can also affect male reproductive strategies. We used horses (Equus caballus) to study this question under experimental conditions. Twelve stallions were individually exposed either to an unfamiliar MHC-similar mare and then to an unfamiliar MHC-dissimilar mare, or vice versa. Each exposure lasted over a period of four weeks. Peripheral blood testosterone levels were determined weekly. Three ejaculates each were collected in the week after exposure to both mares (i.e. in the ninth week) to determine mean sperm number and sperm velocity. We found high testosterone levels when stallions were kept close to MHC-dissimilar mares and significantly lower ones when kept close to MHC-similar mares. Mean sperm number per ejaculate (but not sperm velocity) was positively correlated to mean testosterone levels and also affected by the order of presentation of mares: sperm numbers were higher if MHC-dissimilar mares were presented last than if MHC-similar mares were presented last. We conclude that MHC-linked signals influence testosterone secretion and semen characteristics, two indicators of male reproductive strategies.
Resumo:
The farming exploitation in the Madriu-Perafita-Claror Valley (Principality of Andorra). The Madriu-Perafita-Claror Valley, a natural space located in the Principality of Andorra, has kept a high ecological and landscape value through time. At present, the Valley is considered in the cultural landscape category of the UNESCO World-wide Heritage. A study of the spatial variability of pastures in the Valley conducted from 1994 to 2003 concluded that there was an optimistic future for livestock. This future was mainly explained by new policies in the country, as well as by the new hopes of the tockbreeders. The study also stated that cattle and horse movements within the Valley did not varied over the study period, although entrance and exit points changed. Sheep only fed in the Madriu-Perafita-Claror Valley, but it wouldbe convenient its introduction in other areas where horses and cattle did not pasture. The study concluded that the use of the Valley by the stockbreeders contributed to the development of the vegetation and the landscape, and that the livestock is very important to keep natural and landscape values of the Valley.
Resumo:
[spa]Los bozales y las muserolas en bronce para caballo constituyen unos excepcionales complementos ecuestres cuyo conocimiento se encuentra disperso en una extensa bibliografía. De muchos ejemplares apenas se ha publicado una breve descripción y nunca hasta el presente han sido objeto de un estudio monográfico, quizás por el desaliento que produce el desconocimiento de su procedencia en unos casos, o la superficial noticia del contexto de aparición en la mayoría de ellos, hecho que ha limitado las consideraciones cronológicas y de asociación. La identificación de nuevos ejemplares inéditos en los museos de Barcelona y Lleida ha animado a los autores a emprender un trabajo que por primera vez reúne y revisa los ejemplares conocidos de la Península Ibérica, para los que se propone una descripción normalizada, una clasificación tipológica y, en determinadas piezas, una sustancial revisión de las escenas decorativas y cronologías comúnmente admitidas. La seriación formal y la propuesta de datación implican la referencia de los ejemlares aparecidos en Grecia e Italia. Esa ampliación espacial conduce a replantear los agentes sociales que pueden estar detrás de la propagación de ese complemento ecuestre hasta la peninsua más occidental del Mediterráneo. [eng] Horse muzzles and Bronze muzzles are unique equestrian tools that have been referred to in scattered accounts throughout history. Nevertheless, the majority of these objects have received short descriptions and an overall study is still missing. The lack of a comprehensive study hinges on the over looked importance of these items and the superficial manner that have characterized their documentation. Both these reasons have limited observations on chronology and archaeological investigation. The recent identification of new unpublished exemplars among the Museums" collections in Barcelona and Lleida has encouraged the authors of this paper to start a new study dedicated to these objects. Starting from a catalogue inclusive of all muzzles and muzzles currently known in the Iberian Peninsula, an attempt will be made to propose an accurate description, typological classification and, for some of the items, a revision of the decorative scenes that have marked their place in bronze horse muzzle and muzzle chronology. The formal development and the chronological framework here proposed refer to those of the exemplars found in Greece and in Italy. The broadening of the geographical area will allow reconsideration of those social phenomena that have in the past determined the diffusion of elements in horse tack throughout most of the western Peninsula in the Mediterranean.