843 resultados para Borate buffer solutions
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.
Resumo:
In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.
Resumo:
We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.
Resumo:
In recent years, there has been an increase in research on conventions motivated by the game-theoretic contributions of the philosopher David Lewis. Prior to this surge in interest, discussions of convention in economics had been tied to the analysis of John Maynard Keynes's writings. These literatures are distinct and have very little overlap. Yet this confluence of interests raises interesting methodological questions. Does the use of a common term, convention, denote a set of shared concerns? Can we identify what differentiates the game theoretic models from the Keynesian ones? This paper maps out the three most developed accounts of convention within economics and discusses their relations with each other in an attempt to provide an answer.
Resumo:
MD simulation studies showing the influence of porosity and carbon surface oxidation on phenol adsorption from aqueous solutions on carbons are reported. Based on a realistic model of activated carbon, three carbon structures with gradually changed microporosity were created. Next, a different number of surface oxygen groups was introduced. The pores with diameters around 0.6 nm are optimal for phenol adsorption and after the introduction of surface oxygen functionalities, adsorption of phenol decreases (in accordance with experimental data) for all studied models. This decrease is caused by a pore blocking effect due to the saturation of surface oxygen groups by highly hydrogen-bounded water molecules.
Resumo:
We report the results of first systematic studies of organic adsorption from aqueous solutions onto relatively long single walled carbon nanotubes (four tubes, in initial and oxidised forms). Using molecular dynamics simulations (GROMACS package) we discuss the behaviour of tube-water as well as tube-adsorbate systems, for three different adsorbates (benzene, phenol and paracetamol).
Resumo:
There are approximately 29,000 ha of grass buffer strips in the UK under Agri-Environment Schemes; however, typically they are floristically poor and as such are of limited biodiversity value. Introducing a sown wildflower component has the potential to increase dramatically the value of these buffer strips for a suite of native species, including butterflies. This study investigates management practices aiming to promote the establishment and maintenance of wildflowers in existing buffer strips. The effectiveness of two methods used to increase the establishment of wildflowers for the benefit of native butterfly species were tested, both individually and in combination. The management practices were: (1) the application of a selective graminicide (fluazifop-P-butyl) which reduces the dominance of competitive grasses; and (2) scarification of the soil which creates germination niches for sown wildflower seeds. A wildflower seed mix consisting of nine species was sown in conjunction with the scarification treatment. Responses of wildflowers and butterflies were monitored for two years after establishment. Results indicate that the combined scarification and graminicide treatment produced the greatest cover and species richness of sown wildflowers. Butterfly abundance, species richness and diversity were positively correlated with sown wildflower species richness, with the highest values in the combined scarification and graminicide treatment. These findings have confirmed the importance of both scarification as a means of introducing wildflower seed into existing buffer strips, and subsequent management using graminicides, for the benefit of butterflies. Application of this approach could provide tools to help butterfly conservation on farmland in the future.
Resumo:
The aim of the work was to study the survival of Lactobacillus plantarum NCIMB 8826 in model solutions and develop a mathematical model describing its dependence on pH, citric acid and ascorbic acid. A Central Composite Design (CCD) was developed studying each of the three factors at five levels within the following ranges, i.e., pH (3.0-4.2), citric acid (6-40 g/L), and ascorbic acid (100-1000 mg/L). In total, 17 experimental runs were carried out. The initial cell concentration in the model solutions was approximately 1 × 10(8)CFU/mL; the solutions were stored at 4°C for 6 weeks. Analysis of variance (ANOVA) of the stepwise regression demonstrated that a second order polynomial model fits well the data. The results demonstrated that high pH and citric acid concentration enhanced cell survival; one the other hand, ascorbic acid did not have an effect. Cell survival during storage was also investigated in various types of juices, including orange, grapefruit, blackcurrant, pineapple, pomegranate, cranberry and lemon juice. The model predicted well the cell survival in orange, blackcurrant and pineapple, however it failed to predict cell survival in grapefruit and pomegranate, indicating the influence of additional factors, besides pH and citric acid, on cell survival. Very good cell survival (less than 0.4 log decrease) was observed after 6 weeks of storage in orange, blackcurrant and pineapple juice, all of which had a pH of about 3.8. Cell survival in cranberry and pomegranate decreased very quickly, whereas in the case of lemon juice, the cell concentration decreased approximately 1.1 logs after 6 weeks of storage, albeit the fact that lemon juice had the lowest pH (pH~2.5) among all the juices tested. Taking into account the results from the compositional analysis of the juices and the model, it was deduced that in certain juices, other compounds seemed to protect the cells during storage; these were likely to be proteins and dietary fibre In contrast, in certain juices, such as pomegranate, cell survival was much lower than expected; this could be due to the presence of antimicrobial compounds, such as phenolic compounds.