837 resultados para patógenos contagiosos
Resumo:
The Tahiti lime appears very susceptible to attack by post-harvest diseases, primarily by the fungi Penicillium and Phomopsis, and also because of its high sensitivity to storage at low temperatures. In order to reduce such damage, the present study aimed to verify the efficiency of heat treatment and disinfection of pathogens in the prevention of post-harvest chilling injury of this cultivar and to compare this treatment with other products using the conventional fungicides. The heat treatments were studied with hot-water temperatures ranging between 48 and 56° C. Water at room temperature was used as a control treatment. After treatment, the fruits were kept under cold temperature at 10° C and RH 90% for about 45 days. For comparison, three other treatments were carried out simultaneously, one using imazalil, one with baking soda, and a third with sodium carbonate, these three products being applied by baths in cold water. Two groups of fruit were evaluated, one treated by immersion considering pathogens coming from the field and another by inoculation with spores of the previously isolated pathogens. For the evaluation of physical and chemical parameters of fruits, determinations were made of the skin color, texture, weight loss, size, juice yield, soluble solids, total acidity and vitamin C content. The determination of the sensitivity of the fruit to cold was made by their exposure at temperatures inducing cold damage. The design was a randomized block design with nine treatments, analyzed by the Statgraphics statistical package. Heat treatments, especially at 52° C, were shown to be more promising in the control of pathogenic fungi and cold damage, surpassing the conventional fungicides. No changes were found in the intrinsic and extrinsic parameters in relation to the application of the different treatments.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Patógenos transmitidos por carrapatos atingem uma variedade de hospedeiros vertebrados. Para identificar os agentes patogênicos transmitidos por carrapatos entre cães soropositivos para Leishmania infantum no município Campo Grande-MS, foi realizado um estudo sorológico e molecular para a detecção de Ehrlichia canis, Anaplasma platys e Babesia vogeli em 60 amostras de soro e baço, respectivamente. Adicionalmente, foi realizado o diagnóstico confirmatório de L. infantum por meio de técnicas sorológicas e moleculares. Também foi realizado o alinhamento e análise filogenética das sequências para indicar a identidade das espécies de parasitas que infectam esses animais. Anticorpos IgG anti-Ehrlichia spp., anti-B. vogeli e anti-L. infantum foram detectados em 39 (65%), 49 (81,6%) e 60 (100%) dos cães amostrados, respectivamente. Vinte e sete (45%), cinquenta e quatro (90%), cinquenta e três (88,3%), dois (3,3%) e um (1,6%) cães mostraram-se positivos na PCR para E. canis, Leishmania spp., Leishmania donovani complex, Babesia sp. e Anaplasma sp., respectivamente. Após o seqüenciamento, os amplicons mostraram 99% de similaridade com isolados de E. canis, B. vogeli e A. platys e Leishmania chagasi. Os resultados deste estudo indicaram que os cães soropositivos para L. infantum de Campo Grande, MS, são expostos a vários agentes transmitidos por carrapatos, e, portanto, devem ser incluídos no diagnóstico diferencial em cães com suspeita clínica de leishmaniose.
Resumo:
Streptococcus suis is considered worldwide as one of the pathogens of biggest health and economic impact in the swine industry. Among the serotypes described as zoonotic, serotype 2 is the most frequently isolated from diseased animals and humans in most countries. The study of the epidemiology of S. suis infections in Brazil is important and may help in the development of effective control measures. The aim of this study was to conduct a critical review of Brazilian literature, with support of the world literature, addressing the diagnosis of the agent and its prevalence in clinically ill animals and healthy carriers, especially regarding to the prevalence of the serotype 2 in the country.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
This study aimed to assess the incidence of fungi and nematodes in Brachiaria sp. and Panicum maximum seeds produced in the Brazilian states of Mato Grosso do Sul (MS), Mato Grosso (MT), Goiás (GO), Minas Gerais (MG) and São Paulo (SP). The main fungi found in the seeds were Bipolaris sp., Curvularia sp. and Phoma sp.. The lowest incidence of these fungi was found for seeds of Brachiaria brizantha cultivars BRS Piatã and Xaraés, and Brachiaria decumbens cv. Basilisk, from the states of GO, MG and MS, respectively. The cultivars Marandu and BRS Piatã, from several regions, exhibited high occurrence of Aphelenchoides sp. and Ditylenchus sp.. Seeds of B. humidicola cultivar Humidicola, produced in MS and SP, did not show association with nematodes. The seeds of Panicum maximum cv. Massai and cv. Mombaça showed higher incidence of Bipolaris sp., Cladosporium sp., Curvularia sp., Fusarium sp. and Phoma sp., as well as Aphelenchoides sp. and Ditylenchus sp., especially for seeds produced in MT. Some of the detected pathogens are causative agents of diseases of major importance in forage plants, such as Bipolaris sp., causing leaf spot in Panicum, of high severity in Tanzânia, which provides serious compromising of the pasture sustainability.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The previous knowledge of the infection process and pathogens behavior, for evaluating the physiological potential of maize seeds, is essential for decision making on the final destination of lots that can endanger sowing. This research was carried out in order to study the minimum period required for maize seeds contamination by Fusarium graminearum Schwabe and Fusarium verticillioides (Sacc.) Nirenberg, as well as these pathogens influence on seed germination and vigor, by using the cold test. Three maize seeds hybrids, kept in contact with the pathogens for different periods, were evaluated with and without surface disinfection. After determining the most suitable period, new samples were contaminated by F. graminearum and F. verticillioides, under different infection levels, and subjected to germination tests in sand. The cold test was conducted with healthy and contaminated seeds, at different periods, in a cold chamber. The contact of maize seeds with F. graminearum and F. verticillioides for 16 hours was enough to cause infection. F. graminearum and F. verticillioides did not affect the maize seeds germination, however, F. graminearum reduced the vigor of seeds lots.
Resumo:
The castor bean (Ricinus communis L.) is a tropical oilseed species, and the oil extracted from its seeds is one of the most versatile oils in the nature, showing various industrial uses. Even though it is a rustic species, the castor bean is subjected to several diseases such as the gray mold, caused by the fungus Amphobotrys ricini. Genetic breeding would be the best alternative for the disease control, but a long time is required to obtain resistant cultivars. Thus, the use of control strategies based on chemical, alternative or biological methods shows viable in the short term. The aim of this study was to investigate gray mold control efficiency, in castor bean crop, using chemical, alternative and biological methods. The pathogen control efficiency was evaluated both in vitro and in vivo using fungicides, essential oils and biological control agents. As regards the in vitro inhibition of the pathogen mycelial growth, the best treatments with essential oils were those based on C. martini and C. zeylanicum at all five tested concentrations. For both oils, the average diameter of colonies was 0.7 cm against 4.79 cm for the control treatment. For the fungicides, at all four tested levels, the most efficient active ingredients were methyl tiophanate, carbendazim, tebuconazole and iprodione. The ED50 of these fungicides was <1uL/L, yielding 100% mycelial growth inhibition at all concentrations. As to the inhibition of A. ricini conidium germination, the fungicides tebuconazole and chlorotanolyl were the best at all tested concentrations, and the average of germinated conidia with these fungicides was 0.0 and 0.15%, respectively, against 100% for the control treatment. In the field, treatment with the fungicide iprodione was the best for the disease control when compared to biological and alternative treatments. Under field conditions, the average disease severity for the treatment with iprodione was 15.76% against 95.81% for the inoculated control.
Resumo:
Pós-graduação em Aquicultura - FCAV
Resumo:
Pós-graduação em Biologia Geral e Aplicada - IBB
Resumo:
Pós-graduação em Ciências Biológicas (Genética) - IBB
Resumo:
Pós-graduação em Genética e Melhoramento Animal - FCAV
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
Pós-graduação em Microbiologia Agropecuária - FCAV