Spinal cord T-cell infiltration in the spared nerve injury model of neuropathic pain: a time course study

Background : Numerous studies have shown that immune cells infiltrate the spinal cord after peripheral nerve injury and that they play a major contribution to sensory hypersensitivity in rodents. In particular, the role of monocyte-derived cells and T lymphocytes seems to be prominent in this process. This exciting new perspective in research on neuropathic pain opens many different areas of work, including the understanding of the function of these cells and how they impact on neural function. However, no systematic description of the time course or cell types that characterize this infiltration has been published yet, although this seems to be the rational first step of an overall understanding of the phenomenon. Objective : Describe the time course and cell characteristics of T lymphocyte infiltration in the spinal cord in the Spared Nerve Injury (SNI) model of neuropathic pain in rats. Methods : Collect of lumbar spinal cords of rats at days 2, 7, 21 and 40 after SNI or sham operation (n=4). Immunofluorescence detecting different proteins of T cell subgroups (CD2+CD4+, CD2+CD8+, Th1 markers, Th2 markers, Th17 markers). Quantification of the infiltration rate of the different subgroups. Expected results : First, we expect to see an infiltration of T cells in the spinal cord ipsilateral to nerve injury, higher in SNI rats than in sham animals. Second, we anticipate that different subtypes of T cells penetrate at different time points. Finally, the number of T lymphocytes are expected to decrease at the latest time point, showing a resolution of the process underlying their infiltrating the spinal cord in the first place. Impact : A systematic description of the infiltration of T cells in the spinal cord after peripheral nerve injury is needed to have a better understanding of the role of immune cells in neuropathic pain. The time course that we want to establish will provide the scientific community with new perspectives. First, it will confirm that T cells do indeed infiltrate the spinal cord after SNI in rats. Second, the type of T cells infiltrating at different time points will give clues about their function, in particular their inflammatory or anti-inflammatory profile. From there on, other studies could be lead, investigating the functional side of the specific subtypes put to light by us. Ultimately, this could lead to the discovery of new drugs targeting T cells or their infiltration, in the hope of improving neuropathic pain.

Two Signatures For A New Blood-Based Test For Colorectal Cancer Screening

Background: Detection rates for adenoma and early colorectal cancer (CRC) are unsatisfactory due to low compliance towards invasive screening procedures such as colonoscopy. There is a large unmet screening need calling for an accurate, non-invasive and cost-effective test to screen for early neoplastic and pre-neoplastic lesions. Our goal is to identify effective biomarker combinations to develop a screening test aimed at detecting precancerous lesions and early CRC stages, based on a multigene assay performed on peripheral blood mononuclear cells (PBMC).Methods: A pilot study was conducted on 92 subjects. Colonoscopy revealed 21 CRC, 30 adenomas larger than 1 cm and 41 healthy controls. A panel of 103 biomarkers was selected by two approaches: a candidate gene approach based on literature review and whole transcriptome analysis of a subset of this cohort by Illumina TAG profiling. Blood samples were taken from each patient and PBMC purified. Total RNA was extracted and the 103 biomarkers were tested by multiplex RT-qPCR on the cohort. Different univariate and multivariate statistical methods were applied on the PCR data and 60 biomarkers, with significant p-value (< 0.01) for most of the methods, were selected.Results: The 60 biomarkers are involved in several different biological functions, such as cell adhesion, cell motility, cell signaling, cell proliferation, development and cancer. Two distinct molecular signatures derived from the biomarker combinations were established based on penalized logistic regression to separate patients without lesion from those with CRC or adenoma. These signatures were validated using bootstrapping method, leading to a separation of patients without lesion from those with CRC (Se 67%, Sp 93%, AUC 0.87) and from those with adenoma larger than 1cm (Se 63%, Sp 83%, AUC 0.77). In addition, the organ and disease specificity of these signatures was confirmed by means of patients with other cancer types and inflammatory bowel diseases.Conclusions: The two defined biomarker combinations effectively detect the presence of CRC and adenomas larger than 1 cm with high sensitivity and specificity. A prospective, multicentric, pivotal study is underway in order to validate these results in a larger cohort.

Development of a Conductometric Test for Frost Resistance of Concrete, HR-272, 1988

Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.

Test result-based sampling: an efficient design for estimating the accuracy of patient safety indicators.

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

T-cell and NK-cell infiltration into solid tumors: a key limiting factor for efficacious cancer immunotherapy.

Cancer immunotherapy has great promise, but is limited by diverse mechanisms used by tumors to prevent sustained antitumor immune responses. Tumors disrupt antigen presentation, T/NK-cell activation, and T/NK-cell homing through soluble and cell-surface mediators, the vasculature, and immunosuppressive cells such as myeloid-derived suppressor cells and regulatory T cells. However, many molecular mechanisms preventing the efficacy of antitumor immunity have been identified and can be disrupted by combination immunotherapy. Here, we examine immunosuppressive mechanisms exploited by tumors and provide insights into the therapies under development to overcome them, focusing on lymphocyte traffic.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Selective in vivo visualization of immune-cell infiltration in a mouse model of autoimmune myocarditis by fluorine-19 cardiac magnetic resonance.

BACKGROUND: The goal of this study was to characterize the performance of fluorine-19 ((19)F) cardiac magnetic resonance (CMR) for the specific detection of inflammatory cells in a mouse model of myocarditis. Intravenously administered perfluorocarbons are taken up by infiltrating inflammatory cells and can be detected by (19)F-CMR. (19)F-labeled cells should, therefore, generate an exclusive signal at the inflamed regions within the myocardium. METHODS AND RESULTS: Experimental autoimmune myocarditis was induced in BALB/c mice. After intravenous injection of 2×200 µL of a perfluorocarbon on day 19 and 20 (n=9) after immunization, in vivo (19)F-CMR was performed at the peak of myocardial inflammation (day 21). In 5 additional animals, perfluorocarbon combined with FITC (fluorescein isothiocyanate) was administered for postmortem immunofluorescence and flow-cytometry analyses. Control experiments were performed in 9 animals. In vivo (19)F-CMR detected myocardial inflammation in all experimental autoimmune myocarditis-positive animals. Its resolution was sufficient to identify even small inflammatory foci, that is, at the surface of the right ventricle. Postmortem immunohistochemistry and flow cytometry confirmed the presence of perfluorocarbon in macrophages, dendritic cells, and granulocytes, but not in lymphocytes. The myocardial volume of elevated (19)F signal (rs=0.96; P<0.001), the (19)F signal-to-noise ratio (rs=0.92; P<0.001), and the (19)F signal integral (rs=0.96; P<0.001) at day 21 correlated with the histological myocarditis severity score. CONCLUSIONS: In vivo (19)F-CMR was successfully used to visualize the inflammation specifically and robustly in experimental autoimmune myocarditis, and thus allowed for an unprecedented insight into the involvement of inflammatory cells in the disease process.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.