938 resultados para first-principle studies


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Complexes have been synthesised with bis(2-pyridine carboxaldehyde) ethylenediimine (1) and bis(2-pyridine carboxaldehyde)propylene-1,3-diimine (2) with all of the available lanthanide trinitrates. Crystal structures were obtained for all but one complex with 1 and for all but one complex with 2. Four distinct structural types were established for 1 but only two for 2, although in all cases the structures contained one ligand bound to the metal in a tetradentate fashion. With 1, the four different structures of the lanthanide(III) nitrate complexes included 11-coordinate [Ln(1)(NO3)(3)(H2O)] for Ln = La; 10 coordinate [Ln(1)(NO3)(3)(H2O)] with one monodentate and two bidentate nitrates for Ln = Ce, then 10-coordinate [Ln(1)(NO3)(3)] for Ln = Pr-Yb with three bidentate nitrates; and 9-coordinate [Ln(1)(NO3)(3)] with one monodentate and two bidentate nitrates for Ln = Lu. On the other hand for 2 only two distinct types of structure are obtained, the first type with Ln = La-Pr and the second type for Ln = Sm-Lu, although all are 10-coordinate with stoichiometry [Ln(2)(NO3)(3)]. The difference between the two types is in the disposition of the ligand relative to the nitrates. With the larger lanthanides La-Pr the ligand is found on one side of the coordination sphere with the three nitrate anions on the other. In these structures, the ligand is folded such that the angle between the two pyridine rings approaches 90degrees, while with the smaller lanthanides Sm-Lu, two nitrates are found on one side of the ligand and one nitrate on the other and the ligand is in an extended conformation such that the two pyridine rings are close to being coplanar. In both series of structures, the Ln-N and Ln-O bond lengths were consistent with the lanthanide contraction though there are significant variations between ostensibly equivalent bonds which are indicative of intramolecular hydrogen bonding and steric crowding in the complexes. (C) 2004 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The role of protein kinase C (PKC) activation in ischemic preconditioning remains controversial. Since diacylglycerol is the endogenous activator of PKC and as such might be expected cardioprotective, we have investigated whether: (i) the diacylglycerol analog 1,2-dioctanoyl-sn-glycerol (DOG) can protect against injury during ischemia and reperfusion; (ii) any effect is mediated via PKC activation; and (iii) the outcome is influenced by the time of administration. Isolated rat hearts were perfused with buffer at 37°C and paced at 400 bpm. In Study 1, hearts (n=6/group) were subjected to one of the following: (1) 36 min aerobic perfusion (controls); (2) 20 min aerobic perfusion plus ischemic preconditioning (3 min ischemia/3 min reperfusion+5 min ischemia/5 min reperfusion); (3) aerobic perfusion with buffer containing DOG (10 μM) given as a substitute for ischemic preconditioning; (4) aerobic perfusion with DOG (10 μM) during the last 2 min of aerobic perfusion. All hearts then were subjected to 35 min of global ischemia and 40 min reperfusion. A further group (5) were perfused with DOG (10 μM) for the first 2 min of reperfusion. Ischemic preconditioning improved postischemic recovery of LVDP from 24±3% in controls to 71±2% (P<0.05). Recovery of LVDP also was enhanced by DOG when given just before ischemia (54±4%), however, DOG had no effect on the recovery of LVDP when used as a substitute for ischemic preconditioning (22±5%) or when given during reperfusion (29±6%). In Study 2, the first four groups of study were repeated (n=4–5/group) without imposing the periods of ischemia and reperfusion, instead hearts were taken for the measurement of PKC activity (pmol/min/mg protein±SEM). PKC activity after 36 min in groups (1), (2), (3) and (4) was: 332±102, 299±63, 521±144, and 340±113 and the membrane:cytosolic PKC activity ratio was: 5.6±1.5, 5.3±1.8, 6.6±2.7, and 3.9±2.1 (P=NS in each instance). In conclusion, DOG is cardioprotective but under the conditions of the present study is less cardioprotective than ischemic preconditioning, furthermore the protection does not appear to necessitate PKC activation prior to ischemia.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The strong metal support interaction (SMSI) was first described in 1978 by Tauster [1-4]. The effect was observed as a severely negative effect on CO and H2 uptake on the catalyst after high temperature calcination under reducing conditions (heating above ~ 700 K) [1,2]. It also had a negative effect on the reaction rate for reactions, such as alkane hydrogenolysis [5,6]. It appeared that the effect occurred for catalysts comprised of reducible supports which were treated at elevated temperature in reducing conditions [2-4]. A classic support which has manifested this behaviour in many studies is TiO2. Over the years following the first discovery of SMSI it has been recognised that the effect is not always negative – for instance for the CO-H2 reaction for which it appears to have a positive effect [5,6]. Further it was noted that hydrogen reduction was not necessary to observe the effect of CO adsorption suppression, it also occurs by vacuum treatment [7], though it should be noted that vacuum treatment at elevated temperature is, in effect, a reducing environment.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The interface between water and Langmuir films of long chain aliphatic molecules is investigated using accurate intermolecular potentials. The stabilities of various ice structures which could form at the interface are examined. Antiferroelectric ice is found to be the most stable, but this stability depends crucially on the first layer of water. Ferroelectric structures are found to collapse upon relaxation. Our model was not able to differentiate between the different nucleation properties of C31H63OH and C30H61OH. A better description of the alcohol–water interaction is probably required to account for this difference.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Rh-I-terpyridine complexes have been unambiguously formed for the first time. The 2,21:6',2"-terpyridine (tpy), 4'-chloro-2,2':6',2"-terpyridine (4'-Cl-tpy) and 4'-(tert-butyldimethylsilyl-ortho-carboranyl)-2,2':6',2"-terpyridine (carboranyl-tpy) ligands were used for successful syntheses and characterisation of the corresponding Rh-I complexes with halide coligands, [Rh(X)(4'-Y-terpyridine)] (X = Cl, Y = H, Cl, carboranyl; X = Br, Y = H). All four neutral Rh-tpy complexes are square planar, with Rh-X bonds in the plane of the 4'-Y-terpyridine ligands. Full characterisation of these dark blue, highly air-sensitive compounds was hampered by their poor solubility in various organic solvents. This is mainly due to the formation of pi-stacked aggregates, as evidenced by the crystal structure of [Rh(Cl)(tpy)]; in addition, [Rh(Cl)(carboranyl-tpy)] merely forms discrete dimers. The (bonding) properties of the novel Rh-I-terpyridine complexes have been studied with single-crystal X-ray diffraction, (time-dependent) density functional theoretical (DFT) calculations, far-infrared spectroscopy, electronic absorption spectroscopy and cyclic voltammetry. From DFT calculations, the HOMO of the studied Rh-I-terpyridine complexes involves predominantly the metal centre, while the LUMO resides on the terpyridine ligand. Absorption bands of the studied complexes in the visible region (400-900 nm) can be assigned to MLCT and MLCT/XLCT transitions. The relatively low oxidation potentials of [Rh(X)(tpy)] (X = Cl, Br) point to a high electron density on the metal centre. This makes the Rh-I-terpyridine complexes strongly nucleophilic and (potentially) highly reactive towards various (small) substrate molecules containing carbon-halide bonds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bifidobacteria in the infant faecal microbiota have been the focus of much interest, especially during the exclusive milk-feeding period and in relation to the fortification of infant formulae to better mimic breast milk. However, longitudinal studies examining the diversity and dynamics of the Bifidobacterium population of infants are lacking, particularly in relation to the effects of weaning. Using a polyphasic strategy, the Bifidobacterium populations of breast- and formula-fed infants were examined during the first 18 months of life. Bifidobacterium-specific denaturing gradient gel electrophoresis demonstrated that breast-fed infants harboured greater diversity than formula-fed infants and the diversity of the infants' Bifidobacterium populations increased with weaning. Twenty-seven distinctive banding profiles were observed from ∼1100 infant isolates using ribosomal intergenic spacer analysis, 14 biotypes of which were confirmed to be members of the genus Bifidobacterium. Two profiles (H, Bifidobacterium longum subsp. infantis; and I, Bifidobacterium bifidum) were common culturable biotypes, seen in 9/10 infants, while profile E (Bifidobacterium breve) was common among breast-fed infants. Overall, inter- and intra-individual differences were observed in the Bifidobacterium populations of infants between 1 and 18 months of age, although weaning was associated with increased diversity of the infant Bifidobacterium populations. Breast-fed infants generally harboured a more complex Bifidobacterium microbiota than formula-fed infants.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The night-time tropospheric chemistry of two stress-induced volatile organic compounds (VOCs), (Z)-pent-2-en-1-ol and pent-1-en-3-ol, has been studied at room temperature. Rate coefficients for reactions of the nitrate radical (NO3) with these pentenols were measured using the discharge-flow technique. Because of the relatively low volatility of these compounds, we employed off-axis continuous-wave cavity-enhanced absorption spectroscopy for detection of NO3 in order to be able to work in pseudo first-order conditions with the pentenols in large excess over NO3. The rate coefficients were determined to be (1.53 +/- 0.23) x 10(-13) and (1.39 +/- 0.19) x 10(-14) cm(3) molecule(-1) s(-1) for reactions of NO3 with (Z)-pent-2-en-1-ol and pent-1-en-3-ol. An attempt to study the kinetics of these reactions with a relative-rate technique, using N2O5 as source of NO3 resulted in significantly higher apparent rate coefficients. Performing relative-rate experiments in known excesses of NO2 allowed us to determine the rate coefficients for the N2O5 reactions to be (5.0 +/- 2.8) x 10(-19) cm(3) molecule(-1) s(-1) for (Z)-pent-2-en-1-ol, and (9.1 +/- 5.8) x 10(-19) cm(3) molecule(-1) s(-1) for pent-1-en-3-ol. We show that these relatively slow reactions can indeed interfere with rate determinations in conventional relative-rate experiments.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A dialkylborenium ion stabilized by an N-heterocyclic carbene has been prepared for the first time by reaction of IMes-9-BBN-H with triflic acid. The ion-separated nature of the borenium ion was confirmed by 1H and 19F diffusion ordered NMR spectroscopy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Earth's climate is undoubtedly changing; however, the time scale, consequences and causal attribution remain the subject of significant debate and uncertainty. Detection of subtle indicators from a background of natural variability requires measurements over a time base of decades. This places severe demands on the instrumentation used, requiring measurements of sufficient accuracy and sensitivity that can allow reliable judgements to be made decades apart. The International System of Units (SI) and the network of National Metrology Institutes were developed to address such requirements. However, ensuring and maintaining SI traceability of sufficient accuracy in instruments orbiting the Earth presents a significant new challenge to the metrology community. This paper highlights some key measurands and applications driving the uncertainty demand of the climate community in the solar reflective domain, e.g. solar irradiances and reflectances/radiances of the Earth. It discusses how meeting these uncertainties facilitate significant improvement in the forecasting abilities of climate models. After discussing the current state of the art, it describes a new satellite mission, called TRUTHS, which enables, for the first time, high-accuracy SI traceability to be established in orbit. The direct use of a ‘primary standard’ and replication of the terrestrial traceability chain extends the SI into space, in effect realizing a ‘metrology laboratory in space’.