932 resultados para SKIN EXTRACT


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lolium multiflorum (Lm) grass pollen is the major cause of pollinosis in Southern Brazil. The objectives of this study were to investigate immunodominant components of Lm pollen allergens and the cross-reactivity of IgE with commercial grass pollen allergen extracts. Thirty-eight serum samples from patients with seasonal allergic rhinitis (SAR), 35 serum samples from patients with perennial allergic rhinitis (PAR) and 30 serum samples from non-atopic subjects were analyzed. Allergen sensitization was evaluated using skin prick test and serum IgE levels against Lm pollen extract were determined by ELISA. Inhibition ELISA and immunoblot were used to evaluate the cross-reactivity of IgE between allergens from Lm and commercial grass pollen extracts, including L. perenne (Lp), grass mix I (GI) and II (GII) extracts. IgE antibodies against Lm were detected in 100% of SAR patients and 8.6% of PAR patients. Inhibition ELISA demonstrated IgE cross-reactivity between homologous (Lm) and heterologous (Lp or GII) grass pollen extracts, but not for the GI extract. Fifteen IgE-binding Lm components were detected and immunoblot bands of 26, 28-30, and 32-35 kDa showed >90% recognition. Lm, Lp and GII extracts significantly inhibited IgE binding to the most immunodominant Lm components, particularly the 55 kDa band. The 26 kDa and 90-114 kDa bands presented the lowest amount of heterologous inhibition. We demonstrated that Lm extract contains both Lm-specific and cross-reactive IgE-binding components and therefore it is suitable for measuring quantitative IgE levels for diagnostic and therapeutic purposes in patients with pollinosis sensitized to Lm grass pollen rather than other phylogenetically related grass pollen extracts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We investigated the vascular responses and the blood pressure reducing effects of different fractions obtained from the methanol extract of Loranthus ferrugineus Roxb. (F. Loranthaceae). By means of solvent-solvent extraction, L. ferrugineus methanol extract (LFME) was successively fractionated with chloroform, ethyl acetate and n-butanol. The ability of these LFME fractions to relax vascular smooth muscle against phenylephrine (PE)- and KCl-induced contractions in isolated rat aortic rings was determined. In another set of experiments, LFME fractions were tested for blood pressure lowering activity in anesthetized adult male Sprague-Dawley rats (250-300 g, 14-18 weeks). The n-butanol fraction of LFME (NBF-LFME) produced a significant concentration-dependent inhibition of PE- and KCl-induced aortic ring contractions compared to other fractions. Moreover, NBF-LFME had a significantly higher relaxant effect against PE- than against high K+-induced contractions. In anesthetized Sprague-Dawley rats, NBF-LFME significantly lowered blood pressure in a dose-dependent manner and with a relatively longer duration of action compared to the other fractions. HPLC, UV and IR spectra suggested the presence of terpenoid constituents in both LFME and NBF-LFME. Accordingly, we conclude that NBF-LFME is the most potent fraction producing a concentration-dependent relaxation in vascular smooth muscle in vitro and a dose-dependent blood pressure lowering activity in vivo. The cardiovascular effects of NBF-LFME are most likely attributable to its terpenoid content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visceral leishmaniasis (VL), also known as kala-azar, is an important public health problem. If not treated, virtually all clinically symptomatic patients die within months. The diagnosis is based on the Montenegro skin test (MST) and anti-Leishmania titers. Nevertheless, the time required for cured individuals living in a leishmaniasis-endemic area to present a positive skin test and negative anti-Leishmania serology is known. To determine the cellular and humoral immune response profile in relation to different times post-VL cure, a cross-sectional study was conducted on subjects from a kala-azar endemic area in Paço do Lumiar, MA, Brazil, on the basis of 1995-2005 notifications reported by the National Health Foundation/Regional Coordination of Maranhão. We visited cured individuals with a history of VL within the last 10 years. Seventy-four subjects (30 females) ranging in age from 1 to 44 years were included, all of them symptom free at the time of the study. A cellular immune response was observed in 73 (98.6%) subjects, whereas no significant antibody titers were detected by indirect immunofluorescence (IIF) in the sera of 69 (93.2%) cases. Ten years post-cure, 39 (52%) subjects had a positive MST and negative IIF reaction, while in one subject the skin and anti-Leishmania serology tests were negative. Two other subjects were positive in both tests 1 year after cure. These data suggest that a cellular immune response may still be present in subjects cured of VL regardless of post-cure time, and that the parasite persists in the host after clinical cure of the disease. This would explain the persistence of significant Leishmania sp antibody titers in some subjects after treatment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A 7.4% vaginal extract of the Brazilian pepper tree (Schinus terebinthifolius Raddi) was compared with 0.75% vaginal metronidazole, both manufactured by the Hebron Laboratory, for the treatment of bacterial vaginosis, used at bedtime for 7 nights. The condition was diagnosed using the combined criteria of Amsel and Nugent in two groups of 140 and 137 women, aged between 18 and 40 years. Intention-to-treat analysis was performed. Women were excluded from the study if they presented delayed menstruation, were pregnant, were using or had used any topical or systemic medication, presented any other vaginal infections, presented hymen integrity, or if they reported any history suggestive of acute pelvic inflammatory disease. According to Amsel’s criteria separately, 29 patients (21.2%) treated with the extract and 87 (62.1%) treated with metronidazole were considered to be cured (P < 0.001). According to Nugent’s score separately, 19 women (13.9%) treated with the extract and 79 (56.4%) treated with metronidazole were considered to be cured (P < 0.001). Using the two criteria together, the so-called total cure was observed in 17 women (12.4%) treated with the extract and in 79 women (56.4%) treated with metronidazole (P < 0.001). In conclusion, the cure rate for bacterial vaginosis using a vaginal gel from a pepper tree extract was lower than the rate obtained with metronidazole gel, while side effects were infrequent and non-severe in both groups.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ginkgo biloba extract (GbE) has been indicated as an efficient medicine for the treatment of diabetes mellitus type 2. It remains unclear if its effects are due to an improvement of the insulin signaling cascade, especially in obese subjects. The aim of the present study was to evaluate the effect of GbE on insulin tolerance, food intake, body adiposity, lipid profile, fasting insulin, and muscle levels of insulin receptor substrate 1 (IRS-1), protein tyrosine phosphatase 1B (PTP-1B), and protein kinase B (Akt), as well as Akt phosphorylation, in diet-induced obese rats. Rats were fed with a high-fat diet (HFD) or a normal fat diet (NFD) for 8 weeks. After that, the HFD group was divided into two groups: rats gavaged with a saline vehicle (HFD+V), and rats gavaged with 500 mg/kg of GbE diluted in the saline vehicle (HFD+Gb). NFD rats were gavaged with the saline vehicle only. At the end of the treatment, the rats were anesthetized, insulin was injected into the portal vein, and after 90s, the gastrocnemius muscle was removed. The quantification of IRS-1, Akt, and Akt phosphorylation was performed using Western blotting. Serum levels of fasting insulin and glucose, triacylglycerols and total cholesterol, and LDL and HDL fractions were measured. An insulin tolerance test was also performed. Ingestion of a hyperlipidic diet promoted loss of insulin sensitivity and also resulted in a significant increase in body adiposity, plasma triacylglycerol, and glucose levels. In addition, GbE treatment significantly reduced food intake and body adiposity while it protected against hyperglycemia and dyslipidemia in diet-induced obesity rats. It also enhanced insulin sensitivity in comparison to HFD+V rats, while it restored insulin-induced Akt phosphorylation, increased IRS-1, and reduced PTP-1B levels in gastrocnemius muscle. The present findings suggest that G. biloba might be efficient in preventing and treating obesity-induced insulin signaling impairment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reports on the in vitro antibacterial and in vivo anti-inflammatory properties of a hydroethanolic extract of the aerial parts of Gochnatia pulchra (HEGP). It also describes the antibacterial activity of HEGP fractions and of the isolated compounds genkwanin, scutellarin, apigenin, and 3,5-O-dicaffeoylquinic acid, as evaluated by a broth microdilution method. While HEGP and its fractions did not provide promising results, the isolated compounds exhibited pronounced antibacterial activity. The most sensitive microorganism was Streptococcus pyogenes, with minimum inhibitory concentration (MIC) values of 100, 50 and 25 µg/mL for genkwanin and the flavonoids apigenin and scutellarin, respectively. Genkwanin produced an MIC value of 25 µg/mL against Enterococcus faecalis. A paw edema model in rats and a pleurisy inflammation model in mice aided investigation of the anti-inflammatory effects of HEGP. This study also evaluated the ability of HEGP to modulate carrageenan-induced interleukin-1 beta (IL-1β), tumor necrosis factor alpha (TNF-α), and monocyte chemoattractant protein-1 (MCP-1) production. Orally administered HEGP (250 and 500 mg/kg) inhibited carrageenan-induced paw edema. Regarding carrageenan-induced pleurisy, HEGP at 50, 100, and 250 mg/kg diminished leukocyte migration by 71.43%, 69.24%, and 73.34% (P<0.05), respectively. HEGP suppressed IL-1β and MCP-1 production by 55% and 50% at 50 mg/kg (P<0.05) and 60% and 25% at 100 mg/kg (P<0.05), respectively. HEGP abated TNF-α production by macrophages by 6.6%, 33.3%, and 53.3% at 100, 250, and 500 mg/kg (P<0.05), respectively. HEGP probably exerts anti-inflammatory effects by inhibiting production of the pro-inflammatory cytokines TNF-α, IL-1β, and MCP-1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the effects of pH, dextrose and yeast extract on the cadmium toxicity on Saccharomyces cerevisiae PE-2. In the first assay, the YED mediums with different pH (2, 3, 4, 5, 6, 7, and 8) containing 0.0 and 0.05 mmol Cd L-1 were inoculated with yeast suspension and incubated at 30 °C for 18 hours. During the anaerobic growth, the biomass concentration was determined. The yeast trehalose content, cell viability, and the growth rate were assessed at the beginning and at the end of the growth stages. In the second assay the YED mediums were diluted to the total, ½, and ¼ content of dextrose and yeast and 0.0 and 0.05 mmol Cd L-1 were added. The pH of the mediums was adjusted to 5. The culture mediums were inoculated and incubated at 30 °C for 18 hours. The yeast growth was not affected by cadmium at high pH, but at low pH the yeast becomes more sensitive to the toxic effect. The yeast susceptibility to cadmium was enhanced by the decrease of yeast extract strength and the increase of dextrose strength.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the present work, a hydroethanolic extract was prepared from the entire seeds of pomegranate [Punica granatum L. (Punicaceae)] with Cachaça, a distilled Brazilian alcoholic beverage, protected from light for an 80-hour period. The desorption curve of the seeds, presented an optimal time extraction of approximately 24 hours. The extract was divided into two samples: protected from light, (Extract 1), or not, (Extract 2). The extracts were characterized by UV-Visible absorption spectroscopy, quantification of total phenolics by the Folin-Ciocalteu method, and the antioxidant activity was determined by the DPPH quenching method. Extract 2 presented 9.8% less total polyphenols than Extract 1. The pomegranate seeds extract lost 79% of its antioxidant activity during light exposure. Extract 1 up to 3% (w/v) showed neither cyto nor phototoxicity in the Hela cells. In conclusion, Punica granatum L. seeds contain a significant total polyphenol and TEAC amount and they can be used in simple extractive process, by direct contact with Cachaça in up to 80 hours in the darkness, which gives it good coloration, taste, and smell. This extract showed neither cytotoxicity nor post-irradiation phototoxicity with solar simulator even though the extract proved photoinstable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, bromelain was recovered from ground pineapple stem and rind by means of precipitation with alcohol at low temperature. Bromelain is the name of a group of powerful protein-digesting, or proteolytic, enzymes that are particularly useful for reducing muscle and tissue inflammation and as a digestive aid. Temperature control is crucial to avoid irreversible protein denaturation and consequently to improve the quality of the enzyme recovered. The process was carried out alternatively in two fed-batch pilot tanks: a glass tank and a stainless steel tank. Aliquots containing 100 mL of pineapple aqueous extract were fed into the tank. Inside the jacketed tank, the protein was exposed to unsteady operating conditions during the addition of the precipitating agent (ethanol 99.5%) because the dilution ratio "aqueous extract to ethanol" and heat transfer area changed. The coolant flow rate was manipulated through a variable speed pump. Fine tuned conventional and adaptive PID controllers were on-line implemented using a fieldbus digital control system. The processing performance efficiency was enhanced and so was the quality (enzyme activity) of the product.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of two levels (0.5 and 1%) of hydroalcoholic extract of Achyrocline satureioides on the safety (TBARS values) and quality (pH, water activity, colour, weight loss, and sensorial attributes) of salami was evaluated. The addition of Achyrocline satureioides extract decreased TBARS values significantly during the storage of salami when compared to the control, which was elaborated without Achyrocline satureioides extract. The treatment with 1% of "Marcela" extract showed larger lipid stability than that of the lot with 0.5%, However, it presented a decrease (p < 0.05) in the sensorial acceptance. The two levels of "Marcela" extract did not influence pH, water activity, colour, and weight loss significantly. This study indicates that the hydroalcoholic extract of "Marcela" was effective in decreasing the lipid oxidation and at 0.5% it did not alter the sensorial features; therefore, it may be used in salami to provide safer products for the consumers.