964 resultados para Region of residence
Resumo:
Tumor Suppressor Candidate 2 (TUSC2) is a novel tumor suppressor gene located in the human chromosome 3p21.3 region. TUSC2 mRNA transcripts could be detected on Northern blots in both normal lung and some lung cancer cell lines, but no endogenous TUSC2 protein could be detected in a majority of lung cancer cell lines. Mechanisms regulating TUSC2 protein expression and its inactivation in primary lung cancer cells are largely unknown. We investigated the role of the 5’- and 3’-untranslated regions (UTRs) of the TUSC2 gene in the regulation of TUSC2 protein expression. We found that two small upstream open-reading frames (uORFs) in the 5’UTR of TUSC2 could markedly inhibit the translational initiation of TUSC2 protein by interfering with the “scanning” of the ribosome initiation complexes. Site-specific stem-loop array reverse transcription-polymerase chain reaction (SLA-RT-PCR) verified several micoRNAs (miRNAs) targeted at 3’UTR and directed TUSC2 cleavage and degradation. In addition, we used the established let-7-targeted high mobility group A2 (Hmga2) mRNA as a model system to study the mechanism of regulation of target mRNA by miRNAs in mammalian cells under physiological conditions. There have been no evidence of direct link between mRNA downregulation and mRNA cleavages mediated by miRNAs. Here we showed that the endonucleolytic cleavages on mRNAs were initiated by mammalian miRNA in seed pairing style. Let-7 directed cleavage activities among the eight predicted potential target sites have varied efficiency, which are influenced by the positional and the structural contexts in the UTR. The 5’ cleaved RNA fragments were mostly oligouridylated at their 3’-termini and accumulated for delayed 5’–3’ degradation. RNA fragment oligouridylation played important roles in marking RNA fragments for delayed bulk degradation and in converting RNA degradation mode from 3’–5’ to 5’–3’ with cooperative efforts from both endonucleolytic and non-catalytic miRNA-induced silencing complex (miRISC). Our findings point to a mammalian miRNA-mediated mechanism for the regulation of mRNA that miRNA can decrease target mRNA through target mRNA cleavage and uridine addition
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
During the "Atlantic Expedition" in1965 (IQSY) a comprehensive bathymetric survey and a few hydrographic stations were made by R.V. "Meteor" in the equatorial region of the Mid-Atlantic Ridge. The survey results are shown in a bythymetric chart covering the western parts of the Romanche- and Chain Fracture Zones. West of the original Romanche Trench another deep trench with a medium depth of 6000 m was discovered. The maximum sounding obtained was 7028 m. Both trenches apparently belong to the same fracture zone, but are distinctly separated from each other. The estern boundary of the trench against the Brasil Basin is formed by a sill rising to a depth of about 4400 m. The serial hydrographic observations give some indications of the flow of the cold Westatlantic deep water in the fracture zone area and its influence on the hydrographic conditions in the East-Atlantic Basin. The upper limit of the nearly homogenious Westatlantic bottom water with an Antarctic components lies about 4400 m. The water mass entering the system of trenches of the Romanche Fracture Zone over the western sill originates from the lower part of the discontinuity layer lying above the bottom water. Potential temperatures of 0.6°C were the lowest observed by "Meteor" in the western trench. There seems to be a remarkable tongue of relatively high salinity and a minimum of oxygen in the deep water of this trench. At present we can only speculate upon the origin of this highly saline deep water tongue underneath the eastward moving relatively thin layer of less saline Westatlantic deep water. In the range of the sill separating both trenches a lee wave is indicated by the distribution of salinity and oxygen, which implies a vertical transport of water masses. Caused by this transport it is assumed that relatively cold water may be lifted temporarily to a depth, where it can pass the northbounding ridge, thus getting directly into the Sierra Leone Basin. In the original Romanche Trench the cold Westatlantic deep water seems to fill the whole trough, but its extension remains limited to the trench itself. The water masses found east of the sill separating the trench from the East-Atlantic Basin originate from the lower part of the discontinuity layer. With potential temperatures of about 1.3°C they are much warmer than those observed in the Romanche Trench bottom water.
Resumo:
The position and intensity of the southern westerly wind belt varies seasonally as a consequence of changes in sea surface temperature. During the austral winter, the belt expands northward and the wind intensity in the core decreases. Conversely, during the summer, the belt contracts, and the intensity within the core is strengthened. Reconstructions of the westerly winds since the last glacial maximum, however, have suggested that changes at a single site reflected shifts throughout the entire southern wind belt. Here we use sedimentological and pollen records to reconstruct precipitation patterns over the past 12,500 yr from sites along the windward side of the Andes. Precipitation at the sites, located in the present core and northern margin of the westerlies, is driven almost entirely by the wind belt, and can be used to reconstruct its intensity. Rather than varying coherently throughout the Holocene epoch, we find a distinct anti-phasing of wind strength between the core and northern margin over multi-millennial timescales. During the early Holocene, the core westerlies were strong whereas the northern margin westerlies were weak. We observe the opposite pattern in the late Holocene. As this variation resembles modern seasonal variability, we suggest that our observed changes in westerly wind strength can best be explained by variations in sea surface temperature in the eastern South Pacific Ocean.
Resumo:
The increasing catalogue of high-quality ice-penetrating radar data provides a unique insight in the internal layering architecture of the Greenland ice sheet. The stratigraphy, an indicator of past deformation, highlights irregularities in ice flow and reveals large perturbations without obvious links to bedrock shape. In this work, to establish a new conceptual model for the formation process, we analysed the radar data at the onset of the Petermann Glacier, North Greenland, and created a three-dimensional model of several distinct stratigraphic layers. We demonstrate that the dominant structures are cylindrical folds sub-parallel to the ice flow. By numerical modelling, we show that these folds can be formed by lateral compression of mechanically anisotropic ice, while a general viscosity contrast between layers would not lead to folding for the same boundary conditions. We conclude that the folds primarily form by converging flow as the mechanically anisotropic ice is channelled towards the glacier.
Resumo:
Particular features of tectonic structure and anomalous distribution of geothermal, geomagnetic, and gravity fields in the region of the Sea of Okhotsk are considered. On the basis of heat flow data, ages of large-scale structures in the Sea of Okhotsk are estimated at 65 Ma for the Central Okhotsk Rise and 36 Ma for the South Okhotsk Basin. Age of the South Okhotsk Basin is confirmed by data on kinematics and corresponds to 50 km thickness of the lithosphere. This is in accordance with thickness value obtained by magnetotelluric soundings. Comparative analysis of model geothermal background and measured heat flow values on the Akademii Nauk Rise is performed. Analysis points to abnormally high (~20%) measured heat flow agrees with high negative gradient of gravity anomalies. Estimates of deep heat flow and basement age of riftogenic basins in the Sea of Okhotsk were carried out in the following areas: Deryugin Basin (18 Ma, Early Miocene), TINRO Basin (12 Ma, Middle Miocene), and West Kamchatka Basin (23 Ma, Late Oligocene). Temperatures at boundaries of the main lithological complexes of the sedimentary cover are calculated and zones of oil and gas generation are defined. On the basis of geothermal, magnetic, structural, and other geological-geophysical data a kinematic model of the region of the Sea of Okhotsk for period of 36 Ma was calculated and constructed.
Resumo:
Biogeochemical measurements in sediment cores collected with the submersible JAGO (pusch cores) and a TV-MUC in the Black Sea during MSM15/1, Northwest Crimea (HYPOX Project), at water depths between 152-156 m. A series of microbial mats were sampled on the hypoxic region of the Crimean Shelf. Concentrations of organic carbon (Corg) and nitrogen (N) were measured on finely powdered, freeze-dried subsamples of sediment using a using a Fisons NA-1500 elemental analyzer. For organic carbon determination samples were pre-treated with 12.5% HCl to remove carbonates. Chlorophyll a (chl a), phaeopigments (PHAEO) and chloroplastic pigment equivalents (CPE) was measured according to Schubert et al., (2005) and total hydrolyzable amino acids (THAA) and single amino acid: ASP, GLU, SER, HIS, GLY, THR, ARG, ALA, TYR, MET, VAL, PHE, ILE, LEU, LYS following Dauwe et al., 1998. High-resolution ex situ sulfide and pH microprofiles, were assessed only for station MSM15/1_492_PUC1. "in mat 1, 2 and 3" refers to 3 different profiles in 3 different spots of the microbial mat, whereas "outside mat", a profile outside the microbial mat.