Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Stability of solutions of linear difference equations with periodic coefficients

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.

Biomimetic triblock copolymer membranes: from aqueous solutions to solid supports

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.

A simple fluid cell for the study of aqueous solutions using THz time-domain spectroscopy

We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.

Rational speculative bubbles: an empirical investigation of the London Stock Exchange

In recent years, a sharp divergence of London Stock Exchange equity prices from dividends has been noted. In this paper, we examine whether this divergence can be explained by reference to the existence of a speculative bubble. Three different empirical methodologies are used: variance bounds tests, bubble specification tests, and cointegration tests based on both ex post and ex ante data. We find that, stock prices diverged significantly from their fundamental values during the late 1990's, and that this divergence has all the characteristics of a bubble.

Rational expectations? Developer behaviour and development cycles in the central London office market

Purpose – Expectations of future market conditions are acknowledged to be crucial for the development decision and hence for shaping the built environment. The purpose of this paper is to study the central London office market from 1987 to 2009 and test for evidence of rational, adaptive and naive expectations. Design/methodology/approach – Two parallel approaches are applied to test for either rational or adaptive/naive expectations: vector auto-regressive (VAR) approach with Granger causality tests and recursive OLS regression with one-step forecasts. Findings – Applying VAR models and a recursive OLS regression with one-step forecasts, the authors do not find evidence of adaptive and naïve expectations of developers. Although the magnitude of the errors and the length of time lags between market signal and construction starts vary over time and development cycles, the results confirm that developer decisions are explained, to a large extent, by contemporaneous and historic conditions in both the City and the West End, but this is more likely to stem from the lengthy design, financing and planning permission processes rather than adaptive or naive expectations. Research limitations/implications – More generally, the results of this study suggest that real estate cycles are largely generated endogenously rather than being the result of large demand shocks and/or irrational behaviour. Practical implications – Developers may be able to generate excess profits by exploiting market inefficiencies but this may be hindered in practice by the long periods necessary for planning and construction of the asset. Originality/value – This paper focuses the scholarly debate of real estate cycles on the role of expectations. It is also one of very few spatially disaggregate studies of the subject matter.

Rational intuitionism

In this paper I give a critical overview of the views of the main Rational Intuitionists from 18th to 20th century.

Beyond tokenism? Community-led planning and rational choices: findings from participants in local agenda-setting at the neighbourhood scale in England

The article confronts some key issues raised in the literature on public participation via a series of interrogatory questions drawn from rational choice theory. These are considered in relation to the design and process of public participation opportunities in planning and wider processes of local governance at the neighbourhood scale. In doing this, the article draws on recent research that has looked in some depth at a form of community-led planning (CLP) in England. The motives and expectations of participants, the abilities of participants, as well as the conditions in which participation takes place are seen as important factors. It is contended that the issues raised by rational choice theory are pertinent to emerging efforts to engage communities. As such, the article concludes that advocates of public participation or community engagement should not be afraid of responding to the challenges posed by questions of motive and reward of participants if lasting and worthwhile participation is to be established. Indeed, questions such as 'what's in it for me?' should be regarded as legitimate, necessary and indeed standard, in order to co-devise meaningful and durable participation opportunities and appropriate institutional environments. However, it is also maintained that wider considerations and capacity questions will also need to be confronted if participation is to become embedded as part of participatory neighbourhood-scale planning.