Primary structure of a Thomsen-Friedenreich-antigen-specific lectin, jacalin [Artocarpus integrifolia (jack fruit) agglutinin]. Evidence for the presence of an internal repeat

Jacalin [Artocarpus integrifolia (jack fruit) agglutinin] is made up of two types of chains, heavy and light, with M(r) values of 16,200 +/- 1200 and 2090 +/- 300 respectively (on the basis of gel-permeation chromatography under denaturing conditions). Its complete amino acid sequence was determined by manual degradation using a 4-dimethylaminoazobenzene 4'-isothiocyanate double-coupling method. Peptide fragments for sequence analysis were obtained by chemical cleavages of the heavy chain with CNBr, hydroxylamine hydrochloride and iodosobenzoic acid and enzymic cleavage with Staphylococcus aureus proteinase. The peptides were purified by a combination gel-permeation and reverse-phase chromatography. The light chains, being only 20 residues long, could be sequenced without fragmentation. Amino acid analyses and carboxypeptidase-Y-digestion C-terminal analyses of the subunits provided supportive evidence for their sequence. Computer-assisted alignment of the jacalin heavy-chain sequence failed to show sequence similarity to that of any lectin for which the complete sequence is known. Analyses of the sequence showed the presence of an internal repeat spanning residues 7-64 and 76-130. The internal repeat was found to be statistically significant.

Platelet endothelial cell adhesion molecule 1 (PECAM-1) and its interactions with glycosaminoglycans: 2. Biochemical analyses

Platelet endothelial cell adhesion molecule 1 (PECAM-1) (CD31), a member of the immunoglobulin (Ig) superfamily of cell adhesion molecules with six Ig-like domains, has a range of functions, notably its contributions to leukocyte extravasation during inflammation and in maintaining vascular endothelial integrity. Although PECAM-1 is known to mediate cell adhesion by homophilic binding via domain 1, a number of PECAM-1 heterophilic ligands have been proposed. Here, the possibility that heparin and heparan sulfate (HS) are ligands for PECAM-1 was reinvestigated. The extracellular domain of PECAM-1 was expressed first as a fusion protein with the Fc region of human IgG1 fused to domain 6 and second with an N-terminal Flag tag on domain 1 (Flag-PECAM-1). Both proteins bound heparin immobilized on a biosensor chip in surface plasmon resonance (SPR) binding experiments. Binding was pH-sensitive but is easily measured at slightly acidic pH. A series of PECAM-1 domain deletions, prepared in both expression systems, were tested for heparin binding. This revealed that the main heparin-binding site required both domains 2 and 3. Flag-PECAM-1 and a Flag protein containing domains 1-3 bound HS on melanoma cell surfaces, but a Flag protein containing domains 1-2 did not. Heparin oligosaccharides inhibited Flag-PECAM-1 from binding immobilized heparin, with certain structures having greater inhibitory activity than others. Molecular modeling similarly identified the junction of domains 2 and 3 as the heparin-binding site and further revealed the importance of the iduronic acid conformation for binding. PECAM-1 does bind heparin/HS but by a site that is distinct from that required for homophilic binding.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Computational analyses of the catalytic and heparin-binding sites and their interactions with glycosaminoglycans in glycoside hydrolase family 79 endo-d-glucuronidase (heparanase)

Mammalian heparanase is an endo-β-glucuronidase associated with cell invasion in cancer metastasis, angiogenesis and inflammation. Heparanase cleaves heparan sulfate proteoglycans in the extracellular matrix and basement membrane, releasing heparin/heparan sulfate oligosaccharides of appreciable size. This in turn causes the release of growth factors, which accelerate tumor growth and metastasis. Heparanase has two glycosaminoglycan-binding domains; however, no three-dimensional structure information is available for human heparanase that can provide insights into how the two domains interact to degrade heparin fragments. We have constructed a new homology model of heparanase that takes into account the most recent structural and bioinformatics data available. Heparin analogs and glycosaminoglycan mimetics were computationally docked into the active site with energetically stable ring conformations and their interaction energies were compared. The resulting docked structures were used to propose a model for substrates and conformer selectivity based on the dimensions of the active site. The docking of substrates and inhibitors indicates the existence of a large binding site extending at least two saccharide units beyond the cleavage site (toward the nonreducing end) and at least three saccharides toward the reducing end (toward heparin-binding site 2). The docking of substrates suggests that heparanase recognizes the N-sulfated and O-sulfated glucosamines at subsite +1 and glucuronic acid at the cleavage site, whereas in the absence of 6-O-sulfation in glucosamine, glucuronic acid is docked at subsite +2. These findings will help us to focus on the rational design of heparanase-inhibiting molecules for anticancer drug development by targeting the two heparin/heparan sulfate recognition domains.

Molecular dynamics simulations of CXCL-8 and its interactions with a receptor peptide, heparin fragments, and sulfated linked cyclitols

CXCL-8 (Interleukin 8) is a CXC chemokine with a central role in the human immune response. We have undertaken extensive in silico analyses to elucidate the interactions of CXCL-8 with its various binding partners, which are crucial for its biological function. Sequence and structure analyses showed that residues in the thirdq β-sheet and basic residues in the heparin binding site are highly variable, while residues in the second β-sheet are highly conserved. Molecular dynamics simulations in aqueous solution of dimeric CXCL-8 have been performed with starting geometries from both X-ray and NMR structures showed shearing movements between the two antiparallel C-terminal helices. Dynamic conservation analyses of these simulations agreed with experimental data indicating that structural differences between the two structures at quaternary level arise from changes in the secondary structure of the N-terminal loop, the 310-helix, the 30s, 40s, and 50s loops and the third β-sheet, resulting in a different interhelical separation. Nevertheless, the observation of these different states indicates that CXCL-8 has the potential to undergo conformational changes, and it seems likely that this feature is relevant to the mode of binding of glycosaminoglycan (GAG) mimetics such as cyclitols. Simulations of the receptor peptide fragment−CXCL-8 complex identified several specific interactions of the receptor peptide with CXCL-8 that could be exploited in the structure-based design of competitive peptides and nonpeptidic molecules targeting CXCL-8 for combating inflammatory diseases. Simulations of the CXCL-8 dimer complexed with a 24-mer heparin fragment and of the CXCL-8−receptor peptide complex revealed that Arg60, Lys64, and Arg68 in the dimer bind to cyclitols in a horseshoe pattern, defining a region which is spatially distinct from the receptor binding site. There appears to be an optimum number of sulfates and an optimum length of alkyl spacers required for the interaction of cyclitol inhibitors with the dimeric form of CXCL-8. Calculation of the binding affinities of cyclitol inhibitors reflected satisfactorily the ranking of experimentally determined inhibitory potencies. The findings of these molecular modeling studies will help in the search for inhibitors which can modulate various CXCL-8 biological activities and serve as an excellent model system to study CXC-inhibitor interactions.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Characterization of sequence and structural features of the Candida krusei Enolase

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Identification of IDUA and WNT16 phosphorylation-related non-synonymous polymorphisms for bone mineral density in meta-analyses of genome-wide association studies

Protein phosphorylation regulates a wide variety of cellular processes. Thus, we hypothesize that single-nucleotide polymorphisms (SNPs) that may modulate protein phosphorylation could affect osteoporosis risk. Based on a previous conventional genome-wide association (GWA) study, we conducted a three-stage meta-analysis targeting phosphorylation-related SNPs (phosSNPs) for femoral neck (FN)-bone mineral density (BMD), total hip (HIP)-BMD, and lumbar spine (LS)-BMD phenotypes. In stage 1, 9593 phosSNPs were meta-analyzed in 11,140 individuals of various ancestries. Genome-wide significance (GWS) and suggestive significance were defined by α = 5.21 × 10–6 (0.05/9593) and 1.00 × 10–4, respectively. In stage 2, nine stage 1–discovered phosSNPs (based on α = 1.00 × 10–4) were in silico meta-analyzed in Dutch, Korean, and Australian cohorts. In stage 3, four phosSNPs that replicated in stage 2 (based on α = 5.56 × 10–3, 0.05/9) were de novo genotyped in two independent cohorts. IDUA rs3755955 and rs6831280, and WNT16 rs2707466 were associated with BMD phenotypes in each respective stage, and in three stages combined, achieving GWS for both FN-BMD (p = 8.36 × 10–10, p = 5.26 × 10–10, and p = 3.01 × 10–10, respectively) and HIP-BMD (p = 3.26 × 10–6, p = 1.97 × 10–6, and p = 1.63 × 10–12, respectively). Although in vitro studies demonstrated no differences in expressions of wild-type and mutant forms of IDUA and WNT16B proteins, in silico analyses predicts that WNT16 rs2707466 directly abolishes a phosphorylation site, which could cause a deleterious effect on WNT16 protein, and that IDUA phosSNPs rs3755955 and rs6831280 could exert indirect effects on nearby phosphorylation sites. Further studies will be required to determine the detailed and specific molecular effects of these BMD-associated non-synonymous variants. © 2015 American Society for Bone and Mineral Research.

Chemistry and biology of DNA methyltransferases

Recognition of a specific DNA sequence by a protein is probably the best example of macromolecular interactions leading to various events. It is a prerequisite to understanding the basis of protein-DNA interactions to obtain a better insight into fundamental processes such as transcription, replication, repair, and recombination. DNA methyltransferases with varying sequence specificities provide an excellent model system for understanding the molecular mechanism of specific DNA recognition. Sequence comparison of cloned genes, along with mutational analyses and recent crystallographic studies, have clearly defined the functions of various conserved motifs. These enzymes access their target base in an elegant manner by flipping it out of the DNA double helix. The drastic protein-induced DNA distortion, first reported for HhaI DNA methyltransferase, appears to be a common mechanism employed by various proteins that need to act on bases. A remarkable feature of the catalytic mechanism of DNA (cytosine-5) methyltransferases is the ability of these enzymes to induce deamination of the target cytosine in the absence of S-adenosyl-L-methionine or its analogs. The enzyme-catalyzed deamination reaction is postulated to be the major cause of mutational hotspots at CpG islands responsible for various human genetic disorders. Methylation of adenine residues in Escherichia coli is known to regulate various processes such as transcription, replication, repair, recombination, transposition, and phage packaging.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Microarrays in Lung Cancer Research: From Comparative Analyses to Verified Findings

Keuhkosyöpä on yleisimpiä syöpätauteja. Se jaetaan kahteen päätyyppiin: pienisoluiseen ja ei-pienisoluiseen keuhkosyöpään. Ei-pienisoluinen keuhkosyöpä jaetaan lisäksi alatyyppeihin, joista suurimmat ovat levyepiteeli-, adeno- ja suurisoluinen karsinooma. Keuhkosyövän tärkein riskitekijä on tupakointi, mutta muutkin työ- ja elinympäristön altisteet, kuten asbesti, voivat johtaa syöpään. Väitöstyössä tutkittiin kahdenlaisten keuhkosyöpäryhmien erityispiirteitä. Työssä kartoitettiin, onko löydettävissä muutoksia, jotka erottavat asbestikeuhkosyövät muista syövistä sekä luuytimeen varhaisessa vaiheessa leviävät keuhkosyövät leviämättömistä syövistä. Tutkimusten ensimmäisessä vaiheessa käytettiin mikrosirupohjaisia menetelmiä, jotka mahdollistavat jopa kaikkien geenien tarkastelun yhden kokeen avulla. Vertailevien mikrosirututkimusten avulla on mahdollista paikantaa geenejä tai kromosomialueita, joiden muutokset erottelevat ryhmät toisistaan. Asbestiin liittyvissä tutkimuksissa paikannettiin kuusi kromosomialuetta, joissa geenien kopiolukumäärän sekä ilmenemistason muutokset erottelivat potilaat altistushistorian mukaan. Riippumattomilla laboratoriomenetelmillä tehtyjen jatkoanalyysien avulla pystyttiin varmistamaan, että 19p-alueen häviämä oli yhteydessä asbestialtistukseen. Työssä osoitettiin myös, että 19p-alueen muutoksia voidaan indusoida altistamalla soluja asbestille in vitro. Tutkimuksessa saatiin lisäksi viitteitä asbestispesifisistä muutoksista signaalinvälitysreiteissä, sillä yhdessä toimivien geenien ilmentymisessä havaittiin eroja asbestille altistuneiden ja altistumattomien välillä. Vertailemalla luuytimeen syövän aikaisessa vaiheessa levinneiden ja leviämättömien keuhkoadenokarsinoomien muutosprofiileita toisiinsa, paikannettiin viisi aluetta, joilla geenien kopiolukumäärä- sekä ilmenemistason muutokset erottelivat ryhmät toisistaan. Jatkoanalyyseissä havaittiin, että 4q-alueen häviämää esiintyi adenokarsinoomien lisäksi levyepiteelikarsinoomiin, jotka olivat levinneet luuytimeen. Myös keuhkosyöpien aivometastaaseissa alue oli toistuvasti hävinnyt. Väitöstyön tutkimukset osoittavat, että vertailevien mikrosiruanalyysien avulla saadaan tietoa syöpäryhmien erityispiirteistä. Työssä saadut tulokset osoittavat, että 19p-alueen muutokset ovat tyypillisiä asbestikeuhkosyöville ja 4q-alueen muutokset luuytimeen aikaisessa vaiheessa leviäville keuhkosyöville.

Microbial communities in Pb contaminated boreal forest soil

Lead contamination in the environment is of particular concern, as it is a known toxin. Until recently, however, much less attention has been given to the local contamination caused by activities at shooting ranges compared to large-scale industrial contamination. In Finland, more than 500 tons of Pb is produced each year for shotgun ammunition. The contaminant threatens various organisms, ground water and the health of human populations. However, the forest at shooting ranges usually shows no visible sign of stress compared to nearby clean environments. The aboveground biota normally reflects the belowground ecosystem. Thus, the soil microbial communities appear to bear strong resistance to contamination, despite the influence of lead. The studies forming this thesis investigated a shooting range site at Hälvälä in Southern Finland, which is heavily contaminated by lead pellets. Previously it was experimentally shown that the growth of grasses and degradation of litter are retarded. Measurements of acute toxicity of the contaminated soil or soil extracts gave conflicting results, as enchytraeid worms used as toxicity reporters were strongly affected, while reporter bacteria showed no or very minor decreases in viability. Measurements using sensitive inducible luminescent reporter bacteria suggested that the bioavailability of lead in the soil is indeed low, and this notion was supported by the very low water extractability of the lead. Nevertheless, the frequency of lead-resistant cultivable bacteria was elevated based on the isolation of cultivable strains. The bacterial and fungal diversity in heavily lead contaminated shooting sectors were compared with those of pristine sections of the shooting range area. The bacterial 16S rRNA gene and fungal ITS rRNA gene were amplified, cloned and sequenced using total DNA extracted from the soil humus layer as the template. Altogether, 917 sequenced bacterial clones and 649 sequenced fungal clones revealed a high soil microbial diversity. No effect of lead contamination was found on bacterial richness or diversity, while fungal richness and diversity significantly differed between lead contaminated and clean control areas. However, even in the case of fungi, genera that were deemed sensitive were not totally absent from the contaminated area: only their relative frequency was significantly reduced. Some operational taxonomic units (OTUs) assigned to Basidiomycota were clearly affected, and were much rarer in the lead contaminated areas. The studies of this thesis surveyed EcM sporocarps, analyzed morphotyped EcM root tips by direct sequencing, and 454-pyrosequenced fungal communities in in-growth bags. A total of 32 EcM fungi that formed conspicuous sporocarps, 27 EcM fungal OTUs from 294 root tips, and 116 EcM fungal OTUs from a total of 8 194 ITS2 454 sequences were recorded. The ordination analyses by non-parametric multidimensional scaling (NMS) indicated that Pb enrichment induced a shift in the EcM community composition. This was visible as indicative trends in the sporocarp and root tip datasets, but explicitly clear in the communities observed in the in-growth bags. The compositional shift in the EcM community was mainly attributable to an increase in the frequencies of OTUs assigned to the genus Thelephora, and to a decrease in the OTUs assigned to Pseudotomentella, Suillus and Tylospora in Pb-contaminated areas when compared to the control. The enrichment of Thelephora in contaminated areas was also observed when examining the total fungal communities in soil using DNA cloning and sequencing technology. While the compositional shifts are clear, their functional consequences for the dominant trees or soil ecosystem remain undetermined. The results indicate that at the Hälvälä shooting range, lead influences the fungal communities but not the bacterial communities. The forest ecosystem shows apparent functional redundancy, since no significant effects were seen on forest trees. Recently, by means of 454 pyrosequencing , the amount of sequences in a single analysis run can be up to one million. It has been applied in microbial ecology studies to characterize microbial communities. The handling of sequence data with traditional programs is becoming difficult and exceedingly time consuming, and novel tools are needed to handle the vast amounts of data being generated. The field of microbial ecology has recently benefited from the availability of a number of tools for describing and comparing microbial communities using robust statistical methods. However, although these programs provide methods for rapid calculation, it has become necessary to make them more amenable to larger datasets and numbers of samples from pyrosequencing. As part of this thesis, a new program was developed, MuSSA (Multi-Sample Sequence Analyser), to handle sequence data from novel high-throughput sequencing approaches in microbial community analyses. The greatest advantage of the program is that large volumes of sequence data can be manipulated, and general OTU series with a frequency value can be calculated among a large number of samples.

A promoter-level mammalian expression atlas

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly 'housekeeping', whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.

Draft genome sequence of caloramator mitchellensis, a thermoanaerobe isolated from the waters of the Great Artesian Basin

The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium iso-lated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.