974 resultados para POLYMERASE-GAMMA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gamma-irradiation (gamma-IR) is extensively used in the treatment of hormone-resistant prostate carcinoma. The objective of the present study was to investigate the effects of 60Co gamma-IR on the growth, cell cycle arrest and cell death of the human prostate cancer cell line DU 145. The viability of DU 145 cells was measured by the Trypan blue exclusion assay and the 3(4,5-dimethylthiazol-2-yl)-2,5,diphenyltetrazolium bromide test. Bromodeoxyuridine incorporation was used for the determination of cell proliferation. Cell cycle arrest and cell death were analyzed by flow cytometry. Superoxide dismutase (SOD), specifically CuZnSOD and MnSOD protein expression, after 10 Gy gamma-IR, was determined by Western immunoblotting analysis. gamma-IR treatment had a significant (P < 0.001) antiproliferative and cytotoxic effect on DU 145 cells. Both effects were time and dose dependent. Also, the dose of gamma-IR which inhibited DNA synthesis and cell proliferation by 50% was 9.7 Gy. Furthermore, gamma-IR induced cell cycle arrest in the G2/M phase and the percentage of cells in the G2/M phase was increased from 15% (control) to 49% (IR cells), with a nonsignificant induction of apoptosis. Treatment with 10 Gy gamma-IR for 24, 48, and 72 h stimulated CuZnSOD and MnSOD protein expression in a time-dependent manner, approximately by 3- to 3.5-fold. These data suggest that CuZnSOD and MnSOD enzymes may play an important role in the gamma-IR-induced changes in DU 145 cell growth, cell cycle arrest and cell death.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although Helicobacter heilmannii infection is less common than H. pylori infection in humans, it is considered to be of medical importance because of its association with gastritis, gastric ulcer, carcinoma, and mucosa-associated lymphoid tissue lymphoma of the stomach. However, there have been no studies evaluating the role of the Th cell response in H. heilmannii gastric infection. We evaluated the participation of pro-inflammatory and anti-inflammatory cytokines, IFN-gamma and IL-4, in H. heilmannii gastric infection in genetically IFN-gamma- or IL-4-deficient mice. The serum IFN-gamma and IL-4 concentrations were determined by ELISA. The gastric polymorphonuclear infiltrate was higher (P = 0.007) in H. heilmannii-positive than in H. heilmannii-negative wild-type (WT) C57BL/6 mice, whereas no significant inflammation was demonstrable in the stomach of H. heilmannii-positive IFN-gamma-/- C57BL/6 mice. The degree of gastric inflammatory cells, especially in oxyntic mucosa, was also higher (P = 0.007) in infected IL-4-/- than in WT BALB/c mice. Serum IFN-gamma levels were significantly higher in IL-4-/- than in WT BALB/c mice, independently of H. heilmannii-positive or -negative status. Although no difference in serum IFN-gamma levels was seen between H. heilmannii-positive (11.3 ± 3.07 pg/mL, mean ± SD) and -negative (11.07 ± 3.5 pg/mL) WT BALB/c mice, in the group of IL-4-/- animals, the serum concentration of IFN-g was significantly higher in the infected ones (38.16 ± 10.5 pg/mL, P = 0.04). In contrast, serum IL-4 levels were significantly decreased in H. heilmannii-positive (N = 10) WT BALB/c animals compared to the negative (N = 10) animals. In conclusion, H. heilmannii infection induces a predominantly Th1 immune response, with IFN-gamma playing a central role in gastric inflammation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cloning of the T-cell receptor genes is a critical step when generating T-cell receptor transgenic mice. Because T-cell receptor molecules are clonotypical, isolation of their genes requires reverse transcriptase-assisted PCR using primers specific for each different Valpha or Vß genes or by the screening of cDNA libraries generated from RNA obtained from each individual T-cell clone. Although feasible, these approaches are laborious and costly. The aim of the present study was to test the application of the non-palindromic adaptor-PCR method as an alternative to isolate the genes encoding the T-cell receptor of an antigen-specific T-cell hybridoma. For this purpose, we established hybridomas specific for trans-sialidase, an immunodominant Trypanosoma cruzi antigen. These T-cell hybridomas were characterized with regard to their ability to secrete interferon-gamma, IL-4, and IL-10 after stimulation with the antigen. A CD3+, CD4+, CD8- interferon-gamma-producing hybridoma was selected for the identification of the variable regions of the T-cell receptor by the non-palindromic adaptor-PCR method. Using this methodology, we were able to rapidly and efficiently determine the variable regions of both T-cell receptor chains. The results obtained by the non-palindromic adaptor-PCR method were confirmed by the isolation and sequencing of the complete cDNA genes and by the recognition with a specific antibody against the T-cell receptor variable ß chain. We conclude that the non-palindromic adaptor-PCR method can be a valuable tool for the identification of the T-cell receptor transcripts of T-cell hybridomas and may facilitate the generation of T-cell receptor transgenic mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to evaluate the production of cytokines, interferon-g (INF-g) and interleukin-10 (IL-10), in cultures of peripheral blood mononuclear cells (PBMC) from type 1 and type 2 diabetic patients and to correlate it with inadequate and adequate metabolic control. We studied 11 type 1 and 13 type 2 diabetic patients and 21 healthy individuals divided into two groups (N = 11 and 10) paired by sex and age with type 1 and type 2 diabetic patients. The PBMC cultures were stimulated with concanavalin-A to measure INF-g and IL-10 supernatant concentration by ELISA. For patients with inadequate metabolic control, the cultures were performed on the first day of hospitalization and again after intensive treatment to achieve adequate control. INF-g levels in the supernatants of type 1 diabetic patient cultures were higher compared to type 2 diabetic patients with adequate metabolic control (P < 0.001). Additionally, INF-g and IL-10 tended to increase the liberation of PBMC from type 1 and 2 diabetic patients with adequate metabolic control (P = 0.009 and 0.09, respectively). The increased levels of INF-g and IL-10 released from PBMC of type 1 and 2 diabetic patients with adequate metabolic control suggest that diabetic control improves the capacity of activation and maintenance of the immune response, reducing the susceptibility to infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR) on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ) solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7%) and specificity (60%) were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fetal hemoglobin (HbF), encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their βS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104) and an Afro-descendant one (N = 98), to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP) located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C→T in the HBG1 promoter region were associated with the Central African Republic βS-globin haplotype. In contrast, the -369 C→G and 309 A→G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main objective of the present study was to upgrade a clinical gamma camera to obtain high resolution tomographic images of small animal organs. The system is based on a clinical gamma camera to which we have adapted a special-purpose pinhole collimator and a device for positioning and rotating the target based on a computer-controlled step motor. We developed a software tool to reconstruct the target’s three-dimensional distribution of emission from a set of planar projections, based on the maximum likelihood algorithm. We present details on the hardware and software implementation. We imaged phantoms and heart and kidneys of rats. When using pinhole collimators, the spatial resolution and sensitivity of the imaging system depend on parameters such as the detector-to-collimator and detector-to-target distances and pinhole diameter. In this study, we reached an object voxel size of 0.6 mm and spatial resolution better than 2.4 and 1.7 mm full width at half maximum when 1.5- and 1.0-mm diameter pinholes were used, respectively. Appropriate sensitivity to study the target of interest was attained in both cases. Additionally, we show that as few as 12 projections are sufficient to attain good quality reconstructions, a result that implies a significant reduction of acquisition time and opens the possibility for radiotracer dynamic studies. In conclusion, a high resolution single photon emission computed tomography (SPECT) system was developed using a commercial clinical gamma camera, allowing the acquisition of detailed volumetric images of small animal organs. This type of system has important implications for research areas such as Cardiology, Neurology or Oncology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR) has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra) in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old) were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT) and dapsone, rifampicin and clofazimine for borderline (BB) and lepromatous (LL) forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73) of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306). In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386). PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033). Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-γ) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-γ and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-γ response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-γ) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-γ in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O processo de envelhecimento ou maturação das bebidas proporciona uma melhora nas características sensoriais da cachaça, tornando-a de qualidade superior e de maior valor econômico. O método tradicional de maturação de bebidas é sua interação com madeiras, sendo que a irradiação pode acelerar este processo de envelhecimento. A cachaça e os tonéis de carvalho de 20 L de capacidade foram submetidos à irradiação gama (150 Gy). Análises físico-químicas e cromatográficas foram realizadas periodicamente ao longo de 390 dias do período de envelhecimento da bebida. A irradiação da cachaça e do tonel não alterou a maioria dos componentes voláteis do coeficiente de congêneres como acidez volátil, ésteres, álcoois superiores e furfural durante os 390 dias. Há evidências, entretanto, de que os parâmetros de alguns componentes como aldeídos, taninos, cor e teor de cobre são de alguma forma influenciados, resultando em aceleração parcial do processo de maturação ou envelhecimento. Ao final do período de envelhecimento, foi feita uma análise sensorial com 30 provadores não treinados. A aceleração do processo de envelhecimento foi confirmada pela avaliação sensorial, e a cachaça e/ou tonel irradiados receberam maior indicação de aprovação em todos os parâmetros analisados (aroma, sabor e aparência).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR) has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was conducted to evaluate the physicochemical and microbiological characteristics of raspberries exposed to different radiation doses. The fruits were harvested in the city of Campestre, MG, packed in polyethylene bags, and transported to the Federal University of Lavras (UFLA), where they were separated into 4 lots. Irradiation was performed at the Center for Development of Nuclear Technology in Belo Horizonte, MG. The doses used were 0 (control), 0.5, 1.0, and 2.0 kGy. After irradiation, the fruits were transported back to UFLA and stored at 1 ºC and 95% relative humidity (RH) for 12 days. The physicochemical analyses for mass loss, total soluble solids, titratable acidity, pH, total soluble sugars, total soluble pectin, firmness, vitamin C content, total antioxidant activity, and total phenolic, and the microbiological assays (coliform at 35 and 45 ºC, psychrotrophic and filamentous fungi and yeasts) were performed after 0, 3, 6, 9, and 12 days of storage. Lower loss of mass and filamentous fungi and yeast count were observed in the irradiated fruits, and 2 kGy was determined as the most effective dose for microbial control, but this irradiation dose also resulted in increased loss of fruit firmness.