Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The phylogeography of African Brazilians

Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.

Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

A high-resolution genetic map of the familial Mediterranean fever candidate region allows identification of haplotype-sharing among ethnic groups

Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3, We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the similar to 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (similar to 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that same of these mutations arose before the affected Middle Eastern populations diverged from one another. (C) 1997 Academic Press.

Waterlogging and fire impacts on nitrogen availability and utilization in a subtropical wet heathland (wallum)

Protein, amino acids and ammonium were the main forms of soluble soil nitrogen in the soil solution of a subtropical heathland (wallum). After fire, soil ammonium and nitrate increased 90- and 60-fold, respectively. Despite this increase in nitrate availability after fire, wallum species exhibited uniformly low nitrate reductase activities and low leaf and xylem nitrate, During waterlogging soil amino acids increased, particularly gamma-aminobutyric acid (GABA) which accounted for over 50% of amino nitrogen. Non-mycorrhizal wallum species were significantly (P < 0.05) N-15-enriched (0.3-4.3 parts per thousand) compared to species with mycorrhizal associations (ericoid-type, ecto-, va-mycorrhizal) which were strongly depleted in N-15 (-6.3 to -1.8 parts per thousand). Lignotubers and roots had delta(15)N signatures similar to that of the leaves of respective species. The exceptions were fine roots of ecto-, ecto/va-, and ericoid type mycorrhizal species which were enriched in N-15 (0.1-2 4 parts per thousand). The delta(15)N signatures of delta(15)N(total soil N) and delta(15)N(soil NH4+) were in the range 3.7-4.5 parts per thousand, whereas delta(15)N(soil NO3-) was significantly (P < 0.05) more enriched in N-15 (9.2-9.8 parts per thousand). It is proposed that there is discrimination against N-15 during transfer of nitrogen from fungal to plant partner. Roots of selected species incorporated nitrogen sources in the order of preference: ammonium > glycine > nitrate. The exception were proteoid roots of Hakea (Proteaceae) which incorporated equal amounts of glycine and ammonium.

Mutations in CIC and FUBP1 Contribute to Human Oligodendroglioma

Oligodendrogliomas are the second most common malignant brain tumor in adults and exhibit characteristic losses of chromosomes 1p and 19q. To identify the molecular genetic basis for this alteration, we performed exomic sequencing of seven tumors. Among other changes, we found that the CIC gene (homolog of the Drosophila gene capicua) on chromosome 19q was somatically mutated in six cases and that the FUBP1 gene [encoding far-upstream element (FUSE) binding protein] on chromosome 1p was somatically mutated in two tumors. Examination of 27 additional oligodendrogliomas revealed 12 and 3 more tumors with mutations of CIC and FUBP1, respectively, 58% of which were predicted to result in truncations of the encoded proteins. These results suggest a critical role for these genes in the biology and pathology of oligodendrocytes.

Decreased AIRE Expression and Global Thymic Hypofunction in Down Syndrome

The Down syndrome (DS) immune phenotype is characterized by thymus hypotrophy, higher propensity to organ-specific autoimmune disorders, and higher susceptibility to infections, among other features. Considering that AIRE (autoimmune regulator) is located on 21q22.3, we analyzed protein and gene expression in surgically removed thymuses from 14 DS patients with congenital heart defects, who were compared with 42 age-matched controls with heart anomaly as an isolated malformation. Immunohistochemistry revealed 70.48 +/- 49.59 AIRE-positive cells/mm(2) in DS versus 154.70 +/- 61.16 AIRE-positive cells/mm(2) in controls (p < 0.0001), and quantitative PCR as well as DNA microarray data confirmed those results. The number of FOXP3-positive cells/mm(2) was equivalent in both groups. Thymus transcriptome analysis showed 407 genes significantly hypoexpressed in DS, most of which were related, according to network transcriptional analysis (FunNet), to cell division and to immunity. Immune response-related genes included those involved in 1) Ag processing and presentation (HLA-DQB1, HLA-DRB3, CD1A, CD1B, CD1C, ERAP) and 2) thymic T cell differentiation (IL2RG, RAG2, CD3D, CD3E, PRDX2, CDK6) and selection (SH2D1A, CD74). It is noteworthy that relevant AIRE-partner genes, such as TOP2A, LAMNB1, and NUP93, were found hypoexpressed in DNA microarrays and quantitative real-time PCR analyses. These findings on global thymic hypofunction in DS revealed molecular mechanisms underlying DS immune phenotype and strongly suggest that DS immune abnormalities are present since early development, rather than being a consequence of precocious aging, as widely hypothesized. Thus, DS should be considered as a non-monogenic primary immunodeficiency. The Journal of Immunology, 2011, 187: 3422-3430.

Family context and duration of untreated psychosis (DUP): Results from the Sao Paulo Study

Background: Duration of untreated psychosis (DUP) depends on several factors, including socio-demographic, socioeconomic, clinical and contextual circumstances, such as availability of mental health services. Living arrangements may also play a role, especially in low- and middle-income countries, where most people who develop psychosis live with their relatives. Methods: Population-based study of first-episode psychosis in Sao Paulo, Brazil. Participants were aged 18-64 years, lived in a defined geographic area of the city and had a first contact in life with mental health services due to a psychotic episode. Duration of untreated psychosis was defined as the period between onset of first psychotic symptom and first contact with health service due to psychosis. The median DUP was used to classify participants into short and long DUP. Psychopathology, social adjustment and psychiatric diagnoses were made with standardized assessments. Type of service sought and living arrangements were examined. Results: Two hundred participants were included (52% women, 61% non-affective psychoses). The median DUP was 4.1 weeks (inter-quartile range: 1.9-11.4), and was shorter for affective psychoses. Most participants had their first contact with psychiatric emergency services. Those who did not live with a relative (children older than 18 years, parents, partner) were more likely to present long DUP (OR: 2.63; 95%Cl: 0.98-7.04); p = 0.05). Conclusion: The DUP in Sao Paulo was shorter than expected. Living arrangements may play an important role in shortening the DUP in urban centres of low- and middle income countries that have a network of mental health services. (C) 2009 Elsevier B.V. All rights reserved.

Self-Esteem, Confidence, and Relationships in Brazilian Men with Erectile Dysfunction Receiving Sildenafil Citrate: A Randomized, Parallel-Group, Double-Blind, Placebo-Controlled Study in Brazil

Psychosocial manifestations of erectile dysfunction (ED) differ across cultures. Understanding the treatment response to ED medications within cultural groups can aid in resource allocation and in developing treatment strategies. Evaluate the effect of sildenafil treatment on self-esteem, confidence, and sexual relationship satisfaction in Brazilian men with ED. The Self-Esteem and Relationship (SEAR) questionnaire, a validated, 14-question instrument developed to specifically address self-esteem and relationship issues within the context of ED. Men aged 18 years or older with a clinical diagnosis of ED (<= 21 on the Sexual Health Inventory for Men) and in a stable relationship with a partner during the study were eligible. The primary end point was a change from baseline in the self-esteem subscale of the SEAR questionnaire. Thirteen Brazilian sites participated in a randomized, double-blind, placebo-controlled trial of sildenafil treatment for ED. Patients were randomized to receive either 50 mg of sildenafil (adjustable to 25 mg or 100 mg based on patient response) or matching placebo approximately 1 hour before anticipated sexual activity but not more than once a day. At the end of double-blind treatment, 63 and 66 patients in the placebo and sildenafil groups, respectively, from 13 Brazilian sites were assessed for efficacy. Brazilian patients receiving sildenafil had significantly greater improvements in their scores on the SEAR self-esteem subscale (42.9 [95% confidence interval 35.7-50.0]) compared with placebo (21.1 [95% confidence interval 13.7-28.6]; P < 0.0001). Effect sizes ranged from 0.91 to 1.25 for individual SEAR components. The psychosocial parameters in Brazilian men with ED assessed by the SEAR questionnaire showed significant improvements in self-esteem, confidence, and relationships after treatment with sildenafil. Glina S, Damiao R, Abdo C, Afif-Abdo J, Tseng L-J, and Stecher V. Self-esteem, confidence, and relationships in Brazilian men with erectile dysfunction receiving sildenafil citrate: A randomized, parallel-group, double-blind, placebo-controlled study in Brazil. J Sex Med 2009;6:268-275.

Effects of the addition of methyltestosterone to combined hormone therapy with estrogens and progestogens on sexual energy and on orgasm in postmenopausal women

Objective To evaluate the effect of the addition of methyltestosterone to estrogen and progestogen therapy on postmenopausal sexual energy and orgasm. Methods Sixty postmenopausal women in a stable relationship with a partner capable of intercourse, and presenting sexual complaints that appeared after menopause, were randomly divided into two groups: EP (n=29) received one tablet of equine estrogens (CEE) 0.625mg plus medroxyprogesterone acetate (MPA) 2.5mg and one capsule of placebo; EP+A (n=31) received one tablet of CEE 0.625mg plus MPA 2.5mg and one capsule of methyltestosterone 2.0mg; The treatment period was 12 months. The effects of treatment on sexual energy were assessed using the Sexual Energy Change Scale. The ability to reach orgasm in sexual relations with the partner was verified through monthly calendars and by calculating the ratio between monthly frequency of orgasms in sexual relations and monthly sexual frequency. Results There was a significant relationship between improvement in level of sexual energy and the addition of methyltestosterone to CEE/MPA treatment (p=0.021). No significant effect on orgasmic capacity was noted after the treatment period. Conclusion Addition of methyltestosterone to CEE/MPA therapy may increase sexual energy, but might not affect the ability to obtain orgasm in sexual relations.

High-Resolution Genomic Mapping Reveals Consistent Amplification of the Fibroblast Growth Factor Receptor Substrate 2 Gene in Well-Differentiated and Dedifferentiated Liposarcoma

Well-differentiated liposarcoma (WDLS) is one of the most common malignant mesenchymal tumors and dedifferentiated liposarcoma (DDLS) is a malignant tumor consisting of both WDLS and a transformed nonlipogenic sarcomatous component. Cytogenetically, WDLS is characterized by the presence of ring or giant rod chromosomes containing several amplified genes, including MDM2, TSPAN31 CDK4, and others mainly derived from chromosome bands 12q13-15. However, the 12q13-15 amplicon is large and discontinuous. The focus of this study was to identify novel critical genes that are consistently amplified in primary (nonrecurrent) WDLS and with potential relevance for future targeted therapy. Using a high-resolution (5.0 kb) ""single nucleotide polymorphism""/copy number variation microarray to screen the whole genome in a series of primary WDLS, two consistently amplified areas were found on chromosome 12: one region containing the MDM2 and CPM genes, and another region containing the FRS2 gene. Based on these findings, we further validated FRS2 amplification in both WDLS and DDLS. Fluorescence in situ hybridization confirmed FRS2 amplification in all WDLS and DDLS tested (n = 57). Real time PCR showed FRS2 mRNA transcriptional upregulation in WDLS (n = 19) and DDLS (n = 13) but not in lipoma (n = 5) and normal fat (n = 9). Immunoblotting revealed high expression levels of phospho-FRS2 at 1436 and slightly overexpression of total FRS2 protein in liposarcoma but not in normal fat or preadipocytes. Considering the critical role of FRS2 in mediating fibroblast growth factor receptor signaling, our findings indicate that FRS2 signaling should be further investigated as a potential therapeutic target for liposarcoma. (C) 2011 Wiley-Liss, Inc.

Cytogenetic molecular delineation of a terminal 18q deletion suggesting neo-telomere formation

Deletion of the long arm of chromosome 18 is one of the most common segmental aneusomies compatible with life and usually involves a deletion of the terminal chromosomal region. However, the mechanisms implicated in the stabilization of terminal deletions are not well understood. In this study, we analyzed a girl with moderate mental retardation who had a cytogenetically visible terminal 18q deletion. In order to characterize the breakpoint in the terminal 18q region, we used fluorescence In situ hybridization (FISH) with bacterial artificial chromosomes (BACs) and pan-telomeric probes and also the array technique based on comparative genomic hybridization (array-CGH). FISH with pan-telomeric probes revealed no signal in the terminal region of the deleted chromosome, indicating the absence of normal telomere repeat (TTAGGG)n sequences in 18q. We suggest that neo-telomere formation by chromosome healing was involved in the repair and stabilization of this terminal deletion. (C) 2010 Elsevier Masson SAS. All rights reserved.

Extending the Phenotype of Monosomy 1p36 Syndrome and Mapping of a Critical Region for Obesity and Hyperphagia

Rearrangements of 1p36 are the most frequently detected abnormalities in diagnostic testing for chromosomal cryptic imbalances and include variably sized simple terminal deletions, derivative chromosomes, interstitial deletions, and complex rearrangements. These rearrangements result in the specific pattern of malformation and neurodevelopmental disabilities that characterizes monosomy 1p36 syndrome. Thus far, no individual gene within this region has been conclusively determined to be causative of any component of the phenotype. Nor is it known if the rearrangements convey phenotypes via a haploinsufficiency mechanism or through a position effect. We have used multiplex ligation-dependent probe amplification to screen for deletions of 1p36 in a group of 154 hyperphagic and overweight/obese, PWS negative individuals, and in a separate group of 83 patients initially sent to investigate a variety of other conditions. The strategy allowed the identification and delineation of rearrangements in nine subjects with a wide spectrum of clinical presentations. Our work reinforces the association of monosomy 1p36 and obesity and hyperphagia, and further suggests that these features may be associated with non-classical manifestations of this disorder in addition to a submicroscopic deletion of similar to 2-3 Mb in size. Multiplex ligation probe amplification using the monosomy 1p36 syndrome-specific kit coupled to the subtelomeric kit is an effective approach to identify and delineate rearrangements at 1p36. (C) 2009 Wiley-Liss, Inc.

Violence against women is strongly associated with suicide attempts: Evidence from the WHO multi-country study on women`s health and domestic violence against women

Suicidal behaviours are one of the most important contributors to the global burden of disease among women, but little is known about prevalence and modifiable risk factors in low and middle income countries. We use data from the WHO multi-country study on women`s health and domestic violence against women to examine the prevalence of suicidal thoughts and attempts, and relationships between suicide attempts and mental health status, child sexual abuse, partner violence and other variables. Population representative cross-sectional household surveys were conducted from 2000-2003 in 13 provincial (more rural) and city (urban) sites in Brazil, Ethiopia, japan, Namibia, Peru, Samoa, Serbia, Thailand and Tanzania. 20967 women aged 15-49 years participated. Prevalence of lifetime suicide attempts, lifetime suicidal thoughts, and suicidal thoughts in the past four weeks were calculated, and multivariate logistic regression models were fit to examine factors associated with suicide attempts in each site. Prevalence of lifetime suicide attempts ranged from 0.8% (Tanzania) to 12.0% (Peru city): lifetime thoughts of suicide from 7.2% (Tanzania province) to 29.0% (Peru province), and thoughts in the past four weeks from 1.9% (Serbia) to 13.6% (Peru province). 25-50% of women with suicidal thoughts in the past four weeks had also visited a health worker in that time. The most consistent risk factors for suicide attempts after adjusting for probable common mental health disorders were: intimate partner violence, non-partner physical violence, ever being divorced, separated or widowed, childhood sexual abuse and having a mother who had experienced intimate partner violence. Mental health policies and services must recognise the consistent relationship between violence and suicidality in women in low and middle income countries. Training health sector workers to recognize and respond to the consequences of violence may substantially reduce the health burden associated with suicidal behaviour. (C) 2011 Elsevier Ltd. All rights reserved.

Study of the discovery potential of light custodians in a clean decay channel at the LHC

Models of warped extra dimensions with custodial symmetry usually predict the existence of a light Kaluza-Klein fermion arising as a partner of the right-handed top quark, sometimes called light custodians which we will denote (b) over tilde (R). The production of these particles at the LHC can give rise to multi-W events which could be observed in same-sign dilepton channels, but its mass reconstruction is challenging. In this paper we study the possibility of finding a signal for the pair production of this new particle at the LHC focusing on a rarer, but cleaner decay mode of a light custodian into a Z boson and a b-quark. In this mode it would be possible to reconstruct the light custodian mass. In addition to the dominant standard model QCD production processes, we include the contribution of a Kaluza-Klein gluon first mode. We find that (b) over tilde (R) stands out from the background as a peak in the bZ invariant mass. However, when taking into account only the electronic and muonic decay modes of the Z boson and b-tagging efficiencies, the LHC will have access only to the very light range of masses, m((b) over tilde) = O(500) GeV.