938 resultados para Objective function values
Resumo:
Upper gastrointestinal endoscopy is often accompanied by tachycardia which is known to be an important pathogenic factor in the development of myocardial ischemia. The pathogenesis of tachycardia is unknown but the condition is thought to be due to the endocrine response to endoscopy. The purpose of the present study was to investigate the effects of sedation on the endocrine response and cardiorespiratory function. Forty patients scheduled for diagnostic upper gastrointestinal endoscopy were randomized into 2 groups. While the patients in the first group did not receive sedation during upper gastrointestinal endoscopy, the patients in the second group were sedated with intravenous midazolam at the dose of 5 mg for those under 65 years or 2.5 mg for those aged 65 years or more. Midazolam was administered by slow infusion. In both groups, blood pressure, ECG tracing, heart rate, and peripheral oxygen saturation (SpO2) were monitored during endoscopy. In addition, blood samples for the determination of cortisol, glucose and C-reactive protein levels were obtained from patients in both groups prior to and following endoscopy. Heart rate and systolic arterial pressure changes were within normal limits in both groups. Comparison of the two groups regarding the values of these two parameters did not reveal a significant difference, while a statistically significant reduction in SpO2 was found in the sedation group. No significant differences in serum cortisol, glucose or C-reactive protein levels were observed between the sedated and non-sedated group. Sedation with midazolam did not reduce the endocrine response and the tachycardia developing during upper gastrointestinal endoscopy, but increased the reduction in SpO2.
Resumo:
The role of airway inflammation in ventilated preterm newborns and the risk factors associated with the development of chronic lung disease are not well understood. Our objective was to analyze the association of the airway inflammatory response in ventilated preterm infants by serial measurements of TNF-a and IL-10 in tracheobronchial lavage (TBL) with perinatal factors and lung function measured early in life. A series of TBL samples were collected from ventilated preterm infants (less than 32 weeks of gestational age) and concentrations of TNF-a and IL-10 were measured by ELISA. Pulmonary function tests were performed after discharge by the raised volume rapid compression technique. Twenty-five subjects were recruited and 70 TBL samples were obtained. There was a significant positive association between TNF-a and IL-10 levels and length of time between the rupture of the amniotic membranes and delivery (r = 0.65, P = 0.002, and r = 0.57, P < 0.001, respectively). Lung function was measured between 1 and 22 weeks of corrected age in 10 patients. Multivariable analysis with adjustment for differences in lung volume showed a significant negative association between TNF-a levels and forced expiratory flow (FEF50; r = -0.6; P = 0.04), FEF75 (r = -0.76; P = 0.02), FEF85 (r = -0.75; P = 0.03), FEF25-75 (-0.71; P = 0.02), and FEV0.5 (r = -0.39; P = 0.03). These data suggest that TNF-a levels in the airways during the first days of life were associated with subsequent lung function abnormalities measured weeks or months later.
Resumo:
Inhalation of hypertonic saline (HS) causes bronchoconstriction in asthmatic subjects. Repeated inhalation of HS leads to substantially reduced bronchoconstriction, known as the refractory period. Refractoriness due to different stimuli has also been described (cross-refractoriness). Nocturnal asthma is defined as an increase in symptoms, need for medication, airway responsiveness, and/or worsening of lung function that usually occurs from 4 to 6 am. Our objective was to determine the effect of refractoriness on nocturnal asthma. The challenge test consisted of inhalations of 4.5% saline with increasing durations until a reduction of 20% in forced expiratory volume in 1 s (FEV1) (PD20HS) or total time of 15.5 min. Twelve subjects with nocturnal asthma were challenged with HS at 16:00 and 18:00 h and FEV1 was measured at 4:00 h. One to 2 weeks later, FEV1 was determined at 16:00 and 4:00 h. LogPD20HS at 18:00 h was significantly greater than logPD20HS at 16:00 h, 0.51 ± 0.50 and 0.69 ± 0.60 mg, respectively (P = 0.0033). When subjects underwent two HS challenges in the afternoon, mean (± SD) FEV1 reduction was 206 ± 414 mL or 9.81 ± 17.42%. On the control day (without challenge in the afternoon) FEV1 reduction was 523 ± 308 mL or 22.75 ± 15.40% (P = 0.021). Baseline FEV1 values did not differ significantly between the control and study days, 2.48 ± 0.62 and 2.36 ± 0.46 L, respectively. The refractory period following HS challenges reduces the nocturnal worsening of asthma. This new concept may provide beneficial applications to asthmatic patients.
Resumo:
The objective of the present study was to determine the acute effect of hemodialysis on endothelial venous function and oxidative stress. We studied 9 patients with end-stage renal disease (ESRD), 36.8 ± 3.0 years old, arterial pressure 133.8 ± 6.8/80.0 ± 5.0 mmHg, time on dialysis 55.0 ± 16.6 months, immediately before and after a hemodialysis session, and 10 healthy controls matched for age and gender. Endothelial function was assessed by the dorsal hand vein technique using graded local infusion of acetylcholine (endothelium-dependent venodilation, EDV) and sodium nitroprusside (endothelium-independent venodilation). Oxidative stress was evaluated by measuring protein oxidative damage (carbonyls) and antioxidant defense (total radical trapping antioxidant potential - TRAP) in blood samples. All patients were receiving recombinant human erythropoietin for at least 3 months and were not taking nitrates or a-receptor antagonists. EDV was significantly lower in ESRD patients before hemodialysis (65.6 ± 10.5) vs controls (109.6 ± 10.8; P = 0.010) and after hemodialysis (106.6 ± 15.7; P = 0.045). Endothelium-independent venodilation was similar in all comparisons performed. The hemodialysis session significantly decreased TRAP (402.0 ± 53.5 vs 157.1 ± 28.3 U Trolox/µL plasma; P = 0.001). There was no difference in protein damage comparing ESRD patients before and after hemodialysis. The magnitude of change in the EDV was correlated negatively with the magnitude of change in TRAP (r = -0.70; P = 0.037). These results suggest that a hemodialysis session improves endothelial venous function, in association with an antioxidant effect.
Resumo:
In clinical practice, the glomerular filtration rate (GFR) is often determined with serum creatinine. However, studies have shown cystatin C to be a better parameter for the diagnosis of impaired renal function. We compared GFR estimated by plasma cystatin C with GFR estimated by serum creatinine in a sample of 50 pediatric renal transplant recipients and 24 healthy children. The correlation between GFR estimated by serum creatinine and by cystatin C was significant (r = 0.75; P < 0.001, Person’s correlation); however, in pediatric kidney transplant recipients, the GFR was 6.7 mL/min lower when determined using cystatin C rather than serum creatinine. Moreover, using GFR estimated by cystatin C we found that 42% of the pediatric kidney transplant recipients had an estimated GFR <60 mL·min-1·1.73 (m²)-1, whereas when GFR was estimated by the serum creatinine formula only 16% of the children had values below this cutoff point indicative of chronic kidney disease (P < 0.001). We conclude that, in pediatric kidney transplant recipients, estimation of GFR yields lower values when cystatin C is used rather than serum creatinine.
Resumo:
The objective of the present study was to determine the prevalence of electrolyte disturbances in AIDS patients developing acute kidney injury in the hospital setting, as well as to determine whether such disturbances constitute a risk factor for nephrotoxic and ischemic injury. A prospective, observational cohort study was carried out. Hospitalized AIDS patients were evaluated for age; gender; coinfection with hepatitis; diabetes mellitus; hypertension; time since HIV seroconversion; CD4 count; HIV viral load; proteinuria; serum levels of creatinine, urea, sodium, potassium and magnesium; antiretroviral use; nephrotoxic drug use; sepsis; intensive care unit (ICU) admission, and the need for dialysis. Each of these characteristics was correlated with the development of acute kidney injury, with recovery of renal function and with survival. Fifty-four patients developed acute kidney injury: 72% were males, 59% had been HIV-infected for >5 years, 72% had CD4 counts <200 cells/mm³, 87% developed electrolyte disturbances, 33% recovered renal function, and 56% survived. ICU admission, dialysis, sepsis and hypomagnesemia were all significantly associated with nonrecovery of renal function and with mortality. Nonrecovery of renal function was significantly associated with hypomagnesemia, as was mortality in the multivariate analysis. The risks for nonrecovery of renal function and for death were 6.94 and 6.92 times greater, respectively, for patients with hypomagnesemia. In hospitalized AIDS patients, hypomagnesemia is a risk factor for nonrecovery of renal function and for in-hospital mortality. To determine whether hypomagnesemia is a determinant or simply a marker of critical illness, further studies involving magnesium supplementation in AIDS patients are warranted.
Resumo:
The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.
Resumo:
The objective of this study was to investigate renal function in a cohort of 98 patients with sickle cell disease (SCD) followed up at a tertiary hospital in Brazil. Clinical and laboratory characteristics at the time of the most recent medical examination were analyzed. Renal function was evaluated by the estimation of glomerular filtration rate (GFR) by the criteria of the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI). We compared patients with normal GFR to patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) and hyperfiltration (>120 mL·min-1·(1.73 m²)-1). Comparison between patients according to the use of hydroxyurea and comparison of clinical and laboratory parameters according to GFR were also carried out. Average patient age was 33.8 ± 13.3 years (range 19-67 years), and 57 (58.1%) patients were females. The comparison of patients according to GFR showed that patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) were older, had lower levels of hematocrit, hemoglobin and platelets and higher levels of urea and creatinine. Independent risk factors for decreased GFR were advanced age (OR = 21.6, P < 0.0001) and anemia (OR = 39.6, P < 0.0001). Patients with glomerular hyperfiltration tended to be younger, had higher levels of hematocrit, hemoglobin and platelets and lower levels of urea and creatinine, with less frequent urinary abnormalities. Hydroxyurea, at the dosage of 500-1000 mg/day, was being administered to 28.5% of the patients, and there was no significant difference regarding renal function between the two groups. Further studies are required to establish the best therapeutic approach to renal abnormalities in SCD.
Resumo:
The objective of the present study was to investigate the effects of eccentric training on the activity of mitochondrial respiratory chain enzymes, oxidative stress, muscle damage, and inflammation of skeletal muscle. Eighteen male mice (CF1) weighing 30-35 g were randomly divided into 3 groups (N = 6): untrained, trained eccentric running (16°; TER), and trained running (0°) (TR), and were submitted to an 8-week training program. TER increased muscle oxidative capacity (succinate dehydrogenase and complexes I and II) in a manner similar to TR, and TER did not decrease oxidative damage (xylenol and creatine phosphate) but increased antioxidant enzyme activity (superoxide dismutase and catalase) similar to TR. Muscle damage (creatine kinase) and inflammation (myeloperoxidase) were not reduced by TER. In conclusion, we suggest that TER improves mitochondrial function but does not reduce oxidative stress, muscle damage, or inflammation induced by eccentric contractions.
Resumo:
The maintenance of extracellular Na+ and Cl- concentrations in mammals depends, at least in part, on renal function. It has been shown that neural and endocrine mechanisms regulate extracellular fluid volume and transport of electrolytes along nephrons. Studies of sex hormones and renal nerves suggested that sex hormones modulate renal function, although this relationship is not well understood in the kidney. To better understand the role of these hormones on the effects that renal nerves have on Na+ and Cl- reabsorption, we studied the effects of renal denervation and oophorectomy in female rats. Oophorectomized (OVX) rats received 17β-estradiol benzoate (OVE, 2.0 mg·kg-1·day-1, sc) and progesterone (OVP, 1.7 mg·kg-1·day-1,sc). We assessed Na+ and Cl-fractional excretion (FENa+ and FECl-, respectively) and renal and plasma catecholamine release concentrations. FENa+, FECl-, water intake, urinary flow, and renal and plasma catecholamine release levels increased in OVX vs control rats. These effects were reversed by 17β-estradiol benzoate but not by progesterone. Renal denervation did not alter FENa+, FECl-, water intake, or urinary flow values vs controls. However, the renal catecholamine release level was decreased in the OVP (236.6±36.1 ng/g) and denervated rat groups (D: 102.1±15.7; ODE: 108.7±23.2; ODP: 101.1±22.1 ng/g). Furthermore, combining OVX + D (OD: 111.9±25.4) decreased renal catecholamine release levels compared to either treatment alone. OVE normalized and OVP reduced renal catecholamine release levels, and the effects on plasma catecholamine release levels were reversed by ODE and ODP replacement in OD. These data suggest that progesterone may influence catecholamine release levels by renal innervation and that there are complex interactions among renal nerves, estrogen, and progesterone in the modulation of renal function.
Resumo:
The objective of this study was to evaluate cardiorespiratory fitness and pulmonary function and the relationship with metabolic variables and C-reactive protein (CRP) plasma levels in individuals with diabetes mellitus (DM). Nineteen men with diabetes and 19 age- and gender-matched control subjects were studied. All individuals were given incremental cardiopulmonary exercise and pulmonary function tests. In the exercise test, maximal workload (158.3±22.3vs 135.1±25.2, P=0.005), peak heart rate (HRpeak: 149±12 vs 139±10, P=0.009), peak oxygen uptake (VO2peak: 24.2±3.2 vs18.9±2.8, P<0.001), and anaerobic threshold (VO2VT: 14.1±3.4 vs 12.2±2.2, P=0.04) were significantly lower in individuals with diabetes than in control subjects. Pulmonary function test parameters, blood pressure, lipid profile (triglycerides, HDL, LDL, and total cholesterol), and CRP plasma levels were not different in control subjects and individuals with DM. No correlations were observed between hemoglobin A1C (HbA1c), CRP and pulmonary function test and cardiopulmonary exercise test performance. In conclusion, the results demonstrate that nonsmoking individuals with DM have decreased cardiorespiratory fitness that is not correlated with resting pulmonary function parameters, HbA1c, and CRP plasma levels.
Resumo:
The monoamine serotonin (5-hydroxytryptamine, 5-HT), a well-known neurotransmitter, also has important functions outside the central nervous system. The objective of this study was to investigate the role of 5-HT in the proliferation, differentiation, and function of osteoblasts in vitro. We treated rat primary calvarial osteoblasts with various concentrations of 5-HT (1 nM to 10 µM) and assessed the rate of osteoblast proliferation, expression levels of osteoblast-specific proteins and genes, and the ability to form mineralized nodules. Next, we detected which 5-HT receptor subtypes were expressed in rat osteoblasts at different stages of osteoblast differentiation. We found that 5-HT could inhibit osteoblast proliferation, differentiation, and mineralization at low concentrations, but this inhibitory effect was mitigated at relatively high concentrations. Six of the 5-HT receptor subtypes (5-HT1A, 5-HT1B, 5-HT1D, 5-HT2A, 5-HT2B, and 5-HT2C) were found to exist in rat osteoblasts. Of these, 5-HT2A and 5-HT1Breceptors had the highest expression levels, at both early and late stages of differentiation. Our results indicated that 5-HT can regulate osteoblast proliferation and function in vitro.
Resumo:
Psoriasis is a chronic inflammatory disease that significantly impacts life quality, being associated with stress and mental disorders. We investigated whether the activity of the hypothalamic-pituitary-adrenal (HPA) axis was associated with psoriasis severity, daily life stress and anxiety, and depressive symptoms. In this ancillary study, which was part of the CALIPSO (coronary artery calcium in psoriasis) study, saliva was collected from 102 patients with psoriasis immediately upon awakening, 30, and 60 min after awakening, at 2:00 pm and at bedtime (five time points) to determine salivary cortisol levels. We used Pearson's correlation coefficient to evaluate the association of clinical and psychopathological variables with HPA activity. We found a direct correlation between bedtime cortisol and psoriasis severity evaluated by the psoriasis area severity index (PASI; r=0.39, P<0.001). No correlations between other clinical and psychopathological variables or with other cortisol assessments were observed. The findings indicated that HPA dysfunction may be present in psoriasis, as bedtime cortisol was correlated with psoriasis severity. Our study is limited by the lack of a control group; therefore, we were not able to explore whether these cortisol values were different compared with a concurrent, healthy sample.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The aims of this study were to evaluate the forced oscillation technique (FOT) and pulmonary densitovolumetry in acromegalic patients and to examine the correlations between these findings. In this cross-sectional study, 29 non-smoking acromegalic patients and 17 paired controls were subjected to the FOT and quantification of lung volume using multidetector computed tomography (Q-MDCT). Compared with the controls, the acromegalic patients had a higher value for resonance frequency [15.3 (10.9-19.7) vs 11.4 (9.05-17.6) Hz, P=0.023] and a lower value for mean reactance [0.32 (0.21-0.64) vs 0.49 (0.34-0.96) cm H2O/L/s2, P=0.005]. In inspiratory Q-MDCT, the acromegalic patients had higher percentages of total lung volume (TLV) for nonaerated and poorly aerated areas [0.42% (0.30-0.51%) vs 0.25% (0.20-0.32%), P=0.039 and 3.25% (2.48-3.46%) vs 1.70% (1.45-2.15%), P=0.001, respectively]. Furthermore, the acromegalic patients had higher values for total lung mass in both inspiratory and expiratory Q-MDCT [821 (635-923) vs 696 (599-769) g, P=0.021 and 844 (650-945) vs 637 (536-736) g, P=0.009, respectively]. In inspiratory Q-MDCT, TLV showed significant correlations with all FOT parameters. The TLV of hyperaerated areas showed significant correlations with intercept resistance (rs=−0.602, P<0.001) and mean resistance (rs=−0.580, P<0.001). These data showed that acromegalic patients have increased amounts of lung tissue as well as nonaerated and poorly aerated areas. Functionally, there was a loss of homogeneity of the respiratory system. Moreover, there were correlations between the structural and functional findings of the respiratory system, consistent with the pathophysiology of the disease.