Loss of activator protein-2alpha results in overexpression of the thrombin receptor and correlates with the malignant phenotype of human melanoma

Increasing evidence demonstrates that the thrombin receptor (protease activated receptor-1, PAR-1) plays a major role in tumor invasion and contributes to the metastatic phenotype of human melanoma. We demonstrate that the metastatic potential of human melanoma cells correlates with overexpression of PAR-1. The promoter of the PAR-1 gene contains multiple putative AP-2 and Sp1 consensus elements. We provide evidence that an inverse correlation exists between the expression of AP-2 and the expression of PAR-1 in human melanoma cells. Re-expression of AP-2 in WM266-4 melanoma cells (AP-2 negative) resulted in decreased mRNA and protein expression of PAR-1 and significantly reduced the tumor potential in nude mice. ChIP analysis of the PAR-1 promoter regions bp −365 to −329 (complex 1) and bp −206 to −180 (complex 2) demonstrates that in metastatic cells Sp1 is predominantly binding to the PAR-1 promoter, while in nonmetastatic cells AP-2 is bound. In vitro analysis of complex 1 demonstrates that AP-2 and Sp1 bind to this region in a mutually exclusive manner. Transfection experiments with full-length and progressive deletions of the PAR-1 promoter luciferase constructs demonstrated that metastatic cells had increased promoter activity compared to low and nonmetastatic melanoma cells. Our data shows that exogenous AP-2 expression decreased promoter activity, while transient expression of Sp1 further activated expression of the reporter gene. Mutational analysis of complex 1 within PAR-1 luciferase constructs further demonstrates that the regulation of PAR-1 is mediated through interactions with AP-2 and Sp1. Moreover, loss of AP-2 in metastatic cells alters the AP-2 to Sp1 ratio and DNA-binding activity resulting in overexpression of PAR-1. In addition, we evaluated the expression of AP-2 and PAR-1 utilizing a tissue microarray of 93 melanocytic lesions spanning from benign nevi to melanoma metastasis. We report loss of AP-2 expression in malignant tumors compared to benign tissue while PAR-1 was expressed more often in metastatic melanoma cells than in benign melanocytes. We propose that loss of AP-2 results in increased expression of PAR-1, which in turn results in upregulation of gene products that contribute to the metastatic phenotype of melanoma. ^

BIOCHEMICAL CHARACTERIZATION AND CLINICAL SIGNIFICANCE OF COAGULASE-NEGATIVE STAPHYLOCOCCI

Although coagulase-negative staphylococci (C-NS) have been implicated in certain human infections, they are generally regarded as contaminants and their clinical significance is questioned. To assess their role as pathogens, 205 isolates of C-NS from wounds, and body fluids (blood, urine, pleural and peritoneal fluids, etc.) were studied. Patient's charts were reviewed and using strict criteria a determination was made regarding the clinical significance of these isolates. The organisms were then identified using the scheme of Kloos and Schleifer to determine if certain species of C-NS were associated with specific infections. S. epidermidis sensu stricto accounted for 81% of the C-NS isolated; the frequency of other species was S. haemolyticus (6%), S. hominis (5%), S. capitis (4%), S. warneri (3%), and others (1%). Only two isolates were novobiocin resistant; neither was identified as S. saprophyticus. Using these criteria, 22% of C-NS were considered to be clinically significant and the majority of these (93%) were due to S. epidermidis. The most common source of the clinically relevant C-NS isolates was from wounds. These data suggest that identifying C-NS species other than S. epidermidis may be of limited value in predicting clinical significance.^ In addition, selected pathogenic and non-pathogenic strains of C-NS were compared for their ability to adhere to human cells in vitro. Although the results were not conclusive, it appeared that pathogenic C-NS adhered more avidly than non-pathogenic C-NS to buccal cells. Experiments with HeLa cells showed no difference between pathogenic and non-pathogenic C-NS in adherence abilities. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Role and regulation of c-KIT gene expression in tumor growth and metastasis of human melanoma

The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^

Transcriptional repression of serum amyloid A1 by AP -2 contributes to its liver -specific expression

Studies on the transcriptional regulation of serum amyloid A1 (SAA1) gene, a liver specific acute-phase gene, identified a regulatory element in its promoter that functioned to repress (SAA1) gene transcription in nonliver cells. This silencer element interacts with a nuclear protein that is detectable in HeLa cells, fibroblasts and placental tissues but not in liver or liver-derived cells. As the expression pattern of this repressor is consistent with its potential regulatory role in repressing SAA1 expression, and that many other liver gene promoters also contain this repressor binding site, we sought to investigate whether this repressor may have a broader functional role in repressing liver genes. ^ We have utilized protein purification, cell culture, transient and stable gene transfection, and molecular biology approaches to identify this protein and investigate its possible function in the regulation of (SAA1) and other liver genes. Analyses of amino acid sequence of the purified nuclear protein, and western blot and gel shift studies identified the repressor as transcription factor AP-2 or AP-2-like protein. Using transient transfection of DNA into cultured cells, we demonstrate that AP-2 can indeed function as a repressor to inhibit transcription of SAA1 gene promoter. This conclusion is supported by the following experimental results: (1) overexpression of AP-2 in hepatoma cells inhibits conditioned medium (CM)-induced expression of SAA1 promoter; (2) binding of AP-2 to the SAA1 promoter is required for AP-2 repression function; (3) one mechanism by which AP-2 inhibits SAA1 may be by antagonizing the activation function of the strong transactivator NFκB; (4) mutation of AP-2 binding sites results in derepression of SAM promoter in HeLa cells; and (5) inhibition of endogenous AP-2 activity by a dominant-negative mutant abolishes AP-2's inhibitory effect on SAM promoter in HeLa cells. In addition to the SAM promoter, AP-2 also can bind to the promoter regions of six other liver genes tested, suggesting that it may have a broad functional role in restricting the expression of many liver genes in nonliver cells. Consistent with this notion, ectopic expression of AP-2 also represses CM-mediated activation of human third component of complement 3 promoter. Finally, in AP-2-expressing stable hepatoma cell lines, AP-2 inhibits not only the expression of endogenous SAA, but also the expression of several other endogenous liver genes including albumin, α-fetoprotein. ^ Our findings that AP-2 has the ability to repress the expression of liver genes in nonliver cells opens a new avenue of investigation of negative regulation of gene transcription, and should improve our understanding of tissue-specific expression of liver genes. In summary, our data provide evidence suggesting a novel role of AP-2 as a repressor, inhibiting the expression of liver genes in nonliver cells. Thus, the tissue-specific expression of AP-2 may constitute an important mechanism contributing to the liver-specific expression of liver genes. ^

Intrinsic oxidative stress in cancer cells: A biochemical basis for therapeutic selectivity using ROS -generating agents

A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^

Loss of transformed phenotype in cancer cells by overexpression of the uteroglobin gene

Uteroglobin (UG) is a multifunctional, secreted protein that has receptor-mediated functions. The human UG (hUG) gene is mapped to chromosome 11q12.2–13.1, a region frequently rearranged or deleted in many cancers. Although high levels of hUG expression are characteristic of the mucosal epithelia of many organs, hUG expression is either drastically reduced or totally absent in adenocarcinomas and in viral-transformed epithelial cells derived from the same organs. In agreement with these findings, in an ongoing study to evaluate the effects of aging on UG-knockout mice, 16/16 animals developed malignant tumors, whereas the wild-type littermates (n = 25) remained apparently healthy even after 1½ years. In the present investigation, we sought to determine the effects of induced-expression of hUG in human cancer cells by transfecting several cell lines derived from adenocarcinomas of various organs with an hUG-cDNA construct. We demonstrate that induced hUG expression reverses at least two of the most important characteristics of the transformed phenotype (i.e., anchorage-independent growth on soft agar and extracellular matrix invasion) of only those cancer cells that also express the hUG receptor. Similarly, treatment of the nontransfected, receptor-positive adenocarcinoma cells with purified recombinant hUG yielded identical results. Taken together, these data define receptor-mediated, autocrine and paracrine pathways through which hUG reverses the transformed phenotype of cancer cells and consequently, may have tumor suppressor-like effects.

Chimeric anti-angiogenin antibody cAb 26–2F inhibits the formation of human breast cancer xenografts in athymic mice

Angiogenin (Ang), an inducer of neovascularization, is secreted by several types of human tumor cells and appears critical for their growth. The murine anti-Ang monoclonal antibody (mAb) 26–2F neutralizes the activities of Ang and dramatically prevents the establishment and metastatic dissemination of human tumor cell xenografts in athymic mice. However, for use clinically, the well-documented problem of the human anti-globulin antibody response known to occur with murine antibodies requires resolution. As a result, chimeric as well as totally humanized antibodies are currently being evaluated as therapeutic agents for the treatment of several pathological conditions, including malignancy. Therefore, we have constructed a chimeric mouse/human antibody based on the structure of mAb 26–2F. Complementary DNAs from the light and heavy chain variable regions of mAb 26–2F were cloned, sequenced, and genetically engineered by PCR for subcloning into expression vectors that contain human constant region sequences. Transfection of these vectors into nonproducing mouse myeloma cells resulted in the secretion of fully assembled tetrameric molecules. The chimeric antibody (cAb 26–2F) binds to Ang and inhibits its ribonucleolytic and angiogenic activities as potently as mAb 26–2F. Furthermore, the capacities of cAb 26–2F and its murine counterpart to suppress the formation of human breast cancer tumors in athymic mice are indistinguishable. Thus cAb 26–2F, with its retained neutralization capability and likely decreased immunogenicity, may be of use clinically for the treatment of human cancer and related disorders where pathological angiogenesis is a component.

Inhibition of hypoxia-inducible factor 1 activity by nitric oxide donors in hypoxia

Nitric oxide (NO) is known to have various biologic and pathophysiologic effects on organisms. The molecular mechanisms by which NO exerts harmful effects are unknown, although various O2 radicals and ions that result from reactivity of NO are presumed to be involved. Here we report that adaptive cellular response controlled by the transcription factor hypoxia-inducible factor 1 (HIF-1) in hypoxia is suppressed by NO. Induction of erythropoietin and glycolytic aldolase A mRNAs in hypoxically cultured Hep3B cells, a human hepatoma cell line, was completely and partially inhibited, respectively, by the addition of sodium nitroprusside (SNP), which spontaneously releases NO. A reporter plasmid carrying four hypoxia-response element sequences connected to the luciferase structural gene was constructed and transfected into Hep3B cells. Inducibly expressed luciferase activity in hypoxia was inhibited by the addition of SNP and two other structurally different NO donors, S-nitroso-l-glutathione and 3-morpholinosydnonimine, giving IC50 values of 7.8, 211, and 490 μM, respectively. Inhibition by SNP was also observed in Neuro 2A and HeLa cells, indicating that the inhibition was not cell-type-specific. The vascular endothelial growth factor promoter activity that is controlled by HIF-1 was also inhibited by SNP (IC50 = 6.6 μM). Induction generated by the addition of cobalt ion (this treatment mimics hypoxia) was also inhibited by SNP (IC50 = 2.5 μM). Increased luciferase activity expressed by cotransfection of effector plasmids for HIF-1α or HIF-1α-like factor in hypoxia was also inhibited by the NO donor. We also showed that the inhibition was performed by blocking an activation step of HIF-1α to a DNA-binding form.

Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins

Many cellular events depend on a tightly compartmentalized distribution of H+ ions across membrane-bound organelles. However, measurements of organelle pH in living cells have been scarce. Several mutants of the Aequorea victoria green fluorescent protein (GFP) displayed a pH-dependent absorbance and fluorescent emission, with apparent pKa values ranging from 6.15 (mutations F64L/S65T/H231L) and 6.4 (K26R/F64L/S65T/Y66W/N146I/M153T/V163A/N164H/H231L) to a remarkable 7.1 (S65G/S72A/T203Y/H231L). We have targeted these GFPs to the cytosol plus nucleus, the medial/trans-Golgi by fusion with galactosyltransferase, and the mitochondrial matrix by using the targeting signal from subunit IV of cytochrome c oxidase. Cells in culture transfected with these cDNAs displayed the expected subcellular localization by light and electron microscopy and reported local pH that was calibrated in situ with ionophores. We monitored cytosolic and nuclear pH of HeLa cells, and mitochondrial matrix pH in HeLa cells and in rat neonatal cardiomyocytes. The pH of the medial/trans-Golgi was measured at steady-state (calibrated to be 6.58 in HeLa cells) and after various manipulations. These demonstrated that the Golgi membrane in intact cells is relatively permeable to H+, and that Cl− serves as a counter-ion for H+ transport and likely helps to maintain electroneutrality. The amenability to engineer GFPs to specific subcellular locations or tissue targets using gene fusion and transfer techniques should allow us to examine pH at sites previously inaccessible.

mRNA binding protein mrnp 41 localizes to both nucleus and cytoplasm

We have identified and molecularly characterized a human protein with a Mr of 40,880 Da. After UV irradiation of HeLa cells, this protein was cross-linked to poly(A)-containing mRNA and was therefore designated mrnp 41 (for mRNA binding protein of 41 kDa). Cell fractionation and immunoblotting showed mrnp 41 in both the cytoplasm and the nucleus and particularly in the nuclear envelope. Immunofluorescence microscopy localized mrnp 41 to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. The cytoplasmic meshwork staining was disrupted by prior treatment of cells with the actin filament- or microtubule-disrupting drugs cytochalasin or nocodazole, respectively, suggesting association of mrnp 41 with the cytoskeleton. Double immunofluorescence with antibodies against mrnp 41 and the cytoplasmic poly(A) binding protein showed colocalization to the cytoplasmic meshwork. Immunogold electronmicroscopy confirmed mrnp 41’s cytoplasmic and nucleoplasmic localization and revealed a striking labeling of nuclear pore complexes. Together these data suggest that mrnp 41 may function in nuclear export of mRNPs and/or in cytoplasmic transport on, or attachment to, the cytoskeleton. Consistent with a role of mrnp 41 in nuclear export are previous reports that mutations in homologs of mrnp 41 in Schizosaccharomyces pombe, designated Rae1p, or in Saccharomyces cerevisiae, designated Gle2p, result in mRNA accumulation in the nucleus although it is presently not known whether these homologs are mRNA binding proteins as well.

Antibodies to several conformation-dependent epitopes of gp120/gp41 inhibit CCR-5-dependent cell-to-cell fusion mediated by the native envelope glycoprotein of a primary macrophage-tropic HIV-1 isolate

The β-chemokine receptor CCR-5 is essential for the efficient entry of primary macrophage-tropic HIV-1 isolates into CD4+ target cells. To study CCR-5-dependent cell-to-cell fusion, we have developed an assay system based on the infection of CD4+ CCR-5+ HeLa cells with a Semliki Forest virus recombinant expressing the gp120/gp41 envelope (Env) from a primary clade B HIV-1 isolate (BX08), or from a laboratory T cell line-adapted strain (LAI). In this system, gp120/gp41 of the “nonsyncytium-inducing,” primary, macrophage-tropic HIV-1BX08 isolate, was at least as fusogenic as that of the “syncytium-inducing” HIV-1LAI strain. BX08 Env-mediated fusion was inhibited by the β-chemokines RANTES (regulated upon activation, normal T cell expressed and secreted) and macrophage inflammatory proteins 1β (MIP-1β) and by antibodies to CD4, whereas LAI Env-mediated fusion was insensitive to these β-chemokines. In contrast soluble CD4 significantly reduced LAI, but not BX08 Env-mediated fusion, suggesting that the primary isolate Env glycoprotein has a reduced affinity for CD4. The domains in gp120/gp41 involved in the interaction with the CD4 and CCR-5 molecules were probed using monoclonal antibodies. For the antibodies tested here, the greatest inhibition of fusion was observed with those directed to conformation-dependent, rather than linear epitopes. Efficient inhibition of fusion was not restricted to epitopes in any one domain of gp120/gp41. The assay was sufficiently sensitive to distinguish between antibody- and β-chemokine-mediated fusion inhibition using serum samples from patient BX08, suggesting that the system may be useful for screening human sera for the presence of biologically significant antibodies.

Dominant transformation by mutated human ras genes in vitro requires more than 100 times higher expression than is observed in cancers

The gene-mutation-cancer hypothesis holds that mutated cellular protooncogenes, such as point-mutated proto-ras, “play a dominant part in cancer,” because they are sufficient to transform transfected mouse cell lines in vitro [Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K. & Watson, J. D. (1994) Molecular Biology of the Cell (Garland, New York)]. However, in cells transformed in vitro mutated human ras genes are expressed more than 100-fold than in the cancers from which they are isolated. In view of the discrepancy between the very low levels of ras transcription in cancers and the very high levels in cells transformed in vitro, we have investigated the minimal level of human ras expression for transformation in vitro. Using point-mutated human ras genes recombined with different promoters from either human metallothionein-IIA or human fibronectin or from retroviruses we found dominant in vitro transformation of the mouse C3H cell line only with ras genes linked to viral promoters. These ras genes were expressed more than 120-fold higher than are native ras genes of C3H cells. The copy number of transfected ras genes ranged from 2–6 in our system. In addition, nondominant transformation was observed in a small percentage (2–7%) of C3H cells transfected with ras genes that are expressed less than 20 times higher than native C3H ras genes. Because over 90% of cells expressing ras at this moderately enhanced level were untransformed, transformation must follow either a nondominant ras mechanism or a non-ras mechanism. We conclude that the mutated, but normally expressed, ras genes found in human and animal cancers are not likely to “play a dominant part in cancer.” The conclusion that mutated ras genes are not sufficient or dominant for cancer is directly supported by recent discoveries of mutated ras in normal animals, and in benign human tissue, “which has little potential to progress” [Jen, J., Powell, S. M., Papadopoulos, N., Smith, K. J., Hamilton, S. R., Vogelstein, B. & Kinzler, K. W. (1994) Cancer Res. 54, 5523–5526]. Even the view that mutated ras is necessary for cancer is hard to reconcile with (i) otherwise indistinguishable cancers with and without ras mutations, (ii) metastases of the same human cancers with and without ras mutations, (iii) retroviral ras genes that are oncogenic without point mutations, and (iv) human tumor cells having spontaneously lost ras mutation but not tumorigencity.

Novel Ras antagonist blocks human melanoma growth

During past decades, knowledge of melanoma biology has increased considerably. Numerous therapeutic modalities based on this knowledge are currently under investigation. Advanced melanoma, nevertheless, remains a prime example of poor treatment response that may, in part, be the consequence of activated N-Ras oncoproteins. Besides oncogenic Ras, wild-type Ras gene products also play a key role in receptor tyrosine kinase growth factor signaling, known to be of importance in oncogenesis and tumor progression of a variety of human neoplasms, including malignant melanoma; therefore, it is reasonable to speculate that a pharmacological approach that curtails Ras activity may represent a sensible approach to inhibit melanoma growth. To test this concept, the antitumor activity of S-trans, trans-farnesylthiosalicylic acid (FTS), a recently discovered Ras antagonist that dislodges Ras from its membrane-anchoring sites, was evaluated. The antitumor activity of FTS was assessed both in vitro and in vivo in two independent SCID mouse xenotransplantation models of human melanoma expressing either wild-type Ras (cell line 518A2) or activated Ras (cell line 607B). We show that FTS (5–50 μM) reduces the amounts of activated N-Ras and wild-type Ras isoforms both in human melanoma cells and Rat-1 fibroblasts, interrupts the Ras-dependent extracellular signal-regulated kinase in melanoma cells, inhibits the growth of N-Ras-transformed fibroblasts and human melanoma cells in vitro and reverses their transformed phenotype. FTS also causes a profound and statistically significant inhibition of 518A2 (82%) and 607B (90%) human melanoma growth in SCID mice without evidence of drug-related toxicity. Our findings stress the notion that FTS may qualify as a novel and rational treatment approach for human melanoma and possibly other tumors that either carry activated ras genes or rely on Ras signal transduction more heavily than nonmalignant cells.

The neutral glycosphingolipid globotriaosylceramide promotes fusion mediated by a CD4-dependent CXCR4-utilizing HIV type 1 envelope glycoprotein

Previously, we showed that the addition of human erythrocyte glycosphingolipids (GSLs) to nonhuman CD4+ or GSL-depleted human CD4+ cells rendered those cells susceptible to HIV-1 envelope glycoprotein-mediated cell fusion. Individual components in the GSL mixture were isolated by fractionation on a silica-gel column and incorporated into the membranes of CD4+ cells. GSL-supplemented target cells were then examined for their ability to fuse with TF228 cells expressing HIV-1LAI envelope glycoprotein. We found that one GSL fraction, fraction 3, exhibited the highest recovery of fusion after incorporation into CD4+ nonhuman and GSL-depleted HeLa-CD4 cells and that fraction 3 contained a single GSL fraction. Fraction 3 was characterized by MS, NMR spectroscopy, enzymatic analysis, and immunostaining with an antiglobotriaosylceramide (Gb3) antibody and was found to be Gal(α1→4)Gal(β1→4)Glc-Cer (Gb3). The addition of fraction 3 or Gb3 to GSL-depleted HeLa-CD4 cells recovered fusion, but the addition of galactosylceramide, glucosylceramide, the monosialoganglioside, GM3, lactosylceramide, globoside, the disialoganglioside, GD3, or α-galactosidase A-digested fraction 3 had no effect. Our findings show that the neutral GSL, Gb3, is required for CD4/CXCR4-dependent HIV-1 fusion.