Silencing HIF-1α reduces the adhesion and secretion functions of acute leukemia hBMSCs

Hypoxia inducible factor-1α (HIF-1α) is an important transcription factor, which plays a critical role in the formation of solid tumor and its microenviroment. The objective of the present study was to evaluate the expression and function of HIF-1α in human leukemia bone marrow stromal cells (BMSCs) and to identify the downstream targets of HIF-1α. HIF-1α expression was detected at both the RNA and protein levels using real-time PCR and immunohistochemistry, respectively. Vascular endothelial growth factor (VEGF) and stromal cell-derived factor-1α (SDF-1α) were detected in stromal cells by enzyme-linked immunosorbent assay. HIF-1α was blocked by constructing the lentiviral RNAi vector system and infecting the BMSCs. The Jurkat cell/BMSC co-cultured system was constructed by putting the two cells into the same suitable cultured media and conditions. Cell adhesion and secretion functions of stromal cells were evaluated after transfection with the lentiviral RNAi vector of HIF-1α. Increased HIF-1α mRNA and protein was detected in the nucleus of the acute myeloblastic and acute lymphoblastic leukemia compared with normal BMSCs. The lentiviral RANi vector for HIF-1α was successfully constructed and was applied to block the expression of HIF-1α. When HIF-1α of BMSCs was blocked, the expression of VEGF and SDF-1 secreted by stromal cells were decreased. When HIF-1α was blocked, the co-cultured Jurkat cell’s adhesion and migration functions were also decreased. Taken together, these results suggest that HIF-1α acts as an important transcription factor and can significantly affect the secretion and adhesion functions of leukemia BMSCs.

Leptin receptor (Ob-R) mRNA expression and serum leptin concentration in patients with colorectal and metastatic colorectal cancer

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Associations between CD36 gene polymorphisms and susceptibility to coronary artery heart disease

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effects of propofol on lipopolysaccharide-induced expression and release of HMGB1 in macrophages

This study aimed to determine the effects of different concentrations of propofol (2,6-diisopropylphenol) on lipopolysaccharide (LPS)-induced expression and release of high-mobility group box 1 protein (HMGB1) in mouse macrophages. Mouse macrophage cell line RAW264.7 cells were randomly divided into 5 treatment groups. Expression levels of HMGB1 mRNA were detected using RT-PCR, and cell culture supernatant HMGB1 protein levels were detected using enzyme-linked immunosorbent assay (ELISA). Translocation of HMGB1 from the nucleus to the cytoplasm in macrophages was observed by Western blotting and activity of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in the nucleus was detected using ELISA. HMGB1 mRNA expression levels increased significantly in the cell culture supernatant and in cells after 24 h of stimulating RAW264.7 cells with LPS (500 ng/mL). However, HMGB1 mRNA expression levels in the P2 and P3 groups, which received 500 ng/mL LPS with 25 or 50 μmol/mL propofol, respectively, were significantly lower than those in the group receiving LPS stimulation (P<0.05). After stimulation by LPS, HMGB1 protein levels were reduced significantly in the nucleus but were increased in the cytoplasm (P<0.05). Simultaneously, the activity of NF-κB was enhanced significantly (P<0.05). After propofol intervention, HMGB1 translocation from the nucleus to the cytoplasm and NF-κB activity were inhibited significantly (each P<0.05). Thus, propofol can inhibit the LPS-induced expression and release of HMGB1 by inhibiting HMGB1 translocation and NF-κB activity in RAW264.7 cells, suggesting propofol may be protective in patients with sepsis.

Sorafenib prevents liver fibrosis in a non-alcoholic steatohepatitis (NASH) rodent model

Liver fibrosis occurring as an outcome of non-alcoholic steatohepatitis (NASH) can precede the development of cirrhosis. We investigated the effects of sorafenib in preventing liver fibrosis in a rodent model of NASH. Adult Sprague-Dawley rats were fed a choline-deficient high-fat diet and exposed to diethylnitrosamine for 6 weeks. The NASH group (n=10) received vehicle and the sorafenib group (n=10) received 2.5 mg·kg-1·day-1 by gavage. A control group (n=4) received only standard diet and vehicle. Following treatment, animals were sacrificed and liver tissue was collected for histologic examination, mRNA isolation, and analysis of mitochondrial function. Genes related to fibrosis (MMP9, TIMP1, TIMP2), oxidative stress (HSP60, HSP90, GST), and mitochondrial biogenesis (PGC1α) were evaluated by real-time quantitative polymerase chain reaction (RT-qPCR). Liver mitochondrial oxidation activity was measured by a polarographic method, and cytokines by enzyme-linked immunosorbent assay (ELISA). Sorafenib treatment restored mitochondrial function and reduced collagen deposition by nearly 63% compared to the NASH group. Sorafenib upregulated PGC1α and MMP9 and reduced TIMP1 and TIMP2 mRNA and IL-6 and IL-10 protein expression. There were no differences in HSP60, HSP90 and GST expression. Sorafenib modulated PGC1α expression, improved mitochondrial respiration and prevented collagen deposition. It may, therefore, be useful in the treatment of liver fibrosis in NASH.

The effects of 6-gingerol on proliferation, differentiation, and maturation of osteoblast-like MG-63 cells

We investigated whether 6-gingerol affects the maturation and proliferation of osteoblast-like MG63 cells in vitro. Osteoblast-like MG63 cells were treated with 6-gingerol under control conditions, and experimental inflammation was induced by tumor necrosis factor-α (TNF-α). Expression of different osteogenic markers and cytokines was analyzed by real-time PCR, Western blotting, and enzyme-linked immunosorbent assay. In addition, alkaline phosphatase (ALP) enzyme activity and biomineralization as markers for differentiation were measured. Treatment with 6-gingerol resulted in insignificant effects on the proliferation rate. 6-Gingerol induced the differentiation of osteoblast-like cells with increased transcription levels of osteogenic markers, upregulated ALP enzyme activity, and enhanced mineralized nodule formation. Stimulation with TNF-α led to enhanced interleukin-6 and nuclear factor-κB expression and downregulated markers of osteoblastic differentiation. 6-Gingerol reduced the degree of inflammation in TNF-α-treated MG-63 cells. In conclusion, 6-gingerol stimulated osteoblast differentiation in normal physiological and inflammatory settings, and therefore, 6-gingerol represents a promising agent for treating osteoporosis or bone inflammation.

MFG-E8, a clearance glycoprotein of apoptotic cells, as a new marker of disease severity in chronic obstructive pulmonary disease

Milk fat globule epidermal growth factor 8 (MFG-E8) is an opsonin involved in the phagocytosis of apoptotic cells. In patients with chronic obstructive pulmonary disease (COPD), apoptotic cell clearance is defective. However, whether aberrant MFG-E8 expression is involved in this defect is unknown. In this study, we examined the expression of MFG-E8 in COPD patients. MFG-E8, interleukin (IL)-1β and transforming growth factor (TGF)-β levels were measured in the plasma of 96 COPD patients (93 males, 3 females; age range: 62.12±10.39) and 87 age-matched healthy controls (85 males, 2 females; age range: 64.81±10.11 years) using an enzyme-linked immunosorbent assay. Compared with controls, COPD patients had a significantly lower plasma MFG-E8 levels (P<0.01) and significantly higher plasma TGF-β levels (P=0.002), whereas there was no difference in plasma IL-1β levels between the two groups. Moreover, plasma MFG-E8 levels decreased progressively between Global Initiative for Chronic Obstructive Lung Disease (GOLD) I and GOLD IV stage COPD. Multiple regression analysis showed that the forced expiratory volume in 1 s (FEV1 % predicted) and smoking habit were powerful predictors of MFG-E8 in COPD (P<0.01 and P=0.026, respectively). MFG-E8 was positively associated with the FEV1 % predicted and negatively associated with smoking habit. The area under the receiver operating characteristic curve was 0.874 (95% confidence interval: 0.798-0.95; P<0.01). Our findings demonstrated the utility of MFG-E8 as a marker of disease severity in COPD and that cigarette smoke impaired MFG-E8 expression in these patients.

Galantamine protects against lipopolysaccharide-induced acute lung injury in rats

Lipopolysaccharide (LPS)-induced endotoxemia triggers the secretion of proinflammatory cytokines and can cause acute lung injury (ALI). The high mobility group box 1 (HMGB1) protein plays an important role as a late mediator of sepsis and ALI. Galantamine (GAL) is a central acetylcholinesterase inhibitor that inhibits the expression of HMGB1. This study evaluated the effects of GAL by measuring levels of inflammatory mediators and observing histopathological features associated with LPS-induced ALI. Sixty 8-10 week old male Sprague-Dawley rats (200-240 g) were randomized into three groups as follows: control group, LPS group (7.5 mg/kg LPS), and LPS+GAL group (5 mg/kg GAL before LPS administration). Histopathological examination of lung specimens obtained 12 h after LPS administration was performed to analyze changes in wet-to-dry (W/D) weight ratio, myeloperoxidase (MPO) activity, and HMGB1 expression level. Additionally, plasma concentrations of tumor necrosis factor-α, interleukin-6, and HMGB1 were measured using an enzyme-linked immunosorbent assay at 0 (baseline), 3, 6, 9, and 12 h after LPS administration. Mortality in the three groups was recorded at 72 h. LPS-induced ALI was characterized by distortion of pulmonary architecture and elevation of MPO activity, W/D weight ratio, and levels of pro-inflammatory cytokines, including tumor necrosis factor-α, interleukin-6, and HMGB1. Pretreatment with GAL significantly reduced the LPS-induced lung pathological changes, W/D weight ratio, levels of pro-inflammatory cytokines and MPO activity (ANOVA). Moreover, GAL treatment significantly decreased the mortality rate (ANOVA). In conclusion, we demonstrated that GAL exerted a protective effect on LPS-induced ALI in rats.

Comparação das técnicas de cromatografia em camada delgada e ELISA na quantificação de aflatoxinas em amostras de milho

A comparação das técnicas de Enzyme Linked Immunosorbent Assay (ELISA) e cromatografia em camada delgada (CCD) por quantificação visual e densitométrica foi utilizada na determinação de aflatoxina total, em amostras de milho naturalmente contaminadas. Os teores de aflatoxina total encontrados pelas técnicas de CCD e ELISA, apresentaram maior freqüência na faixa de 0-30 mig/kg e acima de 300 mig/kg. Os resultados das amostras apresentaram coeficiente de variação concentrados abaixo de 20, 30 e 40% para a técnica de ELISA e CCD com quantificação densitométrica e visual, respectivamente. Os coeficientes de correlação foram altamente significativos para as relações entre as quantificações visual e densitométrica (r = 0,9219; t = 26,36; p < 0,001), ELISA e visual (r = 0,8277; t = 17,58; p < 0,001), ELISA e densitometria (r = 0,7373; t = 13,01; p < 0,001), na determinação de aflatoxina total em todas as amostras de milho pesquisadas, confirmando haver equivalência das técnicas estudadas.

COMPORTAMENTO DE ESTAFILOCOCOS COAGULASE NEGATIVOS PAUCIPRODUTORES DE ENTEROTOXINAS, EM ALIMENTOS EXPERIMENTALMENTE INOCULADOS

Linhagens de estafilococos coagulase negativos e pauciprodutores de enterotoxina de A a E, com capacidade de síntese variando de 1,4 a 16ng/mL oriundas de sítios anatômicos de cabras sadias, procedentes da Espanha, foram estudadas com o intuito de se avaliar a capacidade de desenvolvimento e produção de enterotoxina estafilocócica ("SE"), em alimentos experimentalmente inoculados. Para tal, leite integral "tipo longa vida" e presunto cozido foram, de maneira isolada e em duplicata, inoculados com 14 linhagens teste, S.caprae, duas amostras; S.chromogenes; S.cohnii; S.epidermidis; S.haemolyticus, duas amostras; S.hyicus; S.lentus; S.sciuri; S.xylosus, duas amostras; e S.warneri, duas amostras; previamente caracterizadas bioquimicamente. Estes substratos alimentícios, uma vez inoculados, foram mantidos em estufa a 30°C, durante 24 e 48h de incubação e, neste período, submetidos à contagem de células estafilocócicas em ágar Baird Parker e à avaliação de presença de "SE", através do ensaio de "ELISA-SET-EIA, Enzyme Linked-Immunosorbent Assay," e "RPLA, Reversed Passive Latex Agglutination Assay". Os resultados obtidos evidenciaram, tanto em leite integral "tipo longa vida" como em presunto cozido, desenvolvimento mínimo estipulado em 10(6) e máximo de 10(9)UFC/g ou mL do alimento, decorridas 48h de incubação.De acordo com as condições aplicadas neste experimento não apresentaram, contudo, em nenhuma ocasião produção de "SE" que pudesse ter sido detectada .

Presence of central nervous system tissues as bovine spongiform encephalopathy specified risk material in Turkish raw meat ball (cig kofte)

Abstract Bovine Spongiform Encephalopathy (BSE) is a virulent disease which may infect by affecting the central nervous system (CNS) tissues in cattle and causes degeneration in nerves. Central nervous system tissues such as brain and spinal cord which are classified as specified risk materials (SRMs) are regarded to be main source of infection. The contamination of the meat with the specific risk materials (SRMs) can occur in phases of slaughter, fragmentation of carcass and processing. This study was conducted in order to investigate the existence of CNS tissues in raw meat ball (cig kofte) which is commonly consumed in the Southeastern Region of Turkey, particularly in Şanlıurfa. For this purpose, 145 samples of raw meat ball were tested. The enzyme-linked immunosorbent assay (ELISA) kits (Ridascreen risk material 10/5, R-biofarm GmbH) which determine glial fibrillary acidic protein (GFAP) as determinant were used. As a result of the analyses, positivity was detected in 21 of totally 145 samples of raw meat ball (14.48%). 6 (4.14%) of the samples gave low level of positivity (≥ 0.1 standard absorbance), 10 (6.90%) gave medium level of positivity (>0.2 standard absorbance) and 5 (3.45%) gave high level of positivity (≥0.5 standard absorbance). As a consequence, meats are contaminated in any phase of both slaughter and meat production even if accidentally. Regarding this matter, necessary measures should be taken and hygiene rules should be applied.

Há associação entre acyl-grelina e inflamação em pacientes em hemodiálise?

INTRODUÇÃO E OBJETIVOS: Pacientes com doença renal crônica (DRC) apresentam um quadro de anorexia que pode estar relacionado com o processo inflamatório crônico, característico desta população. Assim, o presente estudo teve como objetivo avaliar se há associação entre inflamação e o hormônio orexígeno, acyl-grelina, em pacientes com DRC em hemodiálise (HD). MÉTODOS: Foram estudados 36 pacientes (61,1% homens; 46,7 ± 14,9 anos; IMC 22,9 ± 3,9 kg/m²) em programa regular de HD (65,0 ± 46,8 meses em HD). Os níveis plasmáticos de acyl-grelina e dos marcadores inflamatórios (TNF-α, IL-6 e PCR) foram medidos com o uso do método imunoenzimático (ELISA, Enzyme Linked Immunosorbent Assay). Dados antropométricos foram coletados para avaliação do estado nutricional e a ingestão alimentar foi analisada por meio de recordatório alimentar de 24h de 2 dias. RESULTADOS: Os pacientes apresentaram elevados níveis de IL-6 (83 ± 10 pg/mL), TNF-α (21,06 pg/mL [20,6-40,0]) e PCR (2,7 pg/mL [1,7-3,4]) quando comparados a valores normais. Os níveis plasmáticos de acyl-grelina (18,0 pg/mL [1,3-77,7 pg/mL]) foram baixos comparados com valores de indivíduos saudáveis. Porém, pacientes com elevado IMC (> 25 kg/m²) apresentaram menores concentrações plasmáticas de acyl-grelina (13,6 [1,3-30,5] pg/mL) em relação aos pacientes com IMC < 25 kg/m² (21,7 [7,4-77,7] pg/mL (p < 0,05). Houve correlação negativa entre o IMC e acyl-grelina (r = -0,38; p = 0,02), porém, não houve correlação significativa entre acyl-grelina e os marcadores inflamatórios. CONCLUSÃO: Apesar dos pacientes em HD apresentarem baixas concentrações de acyl-grelina e uma provável resistência a este hormônio, não houve associação entre inflamação e acyl-grelina.

Herpesviruses including novel gammaherpesviruses are widespread among phocid seal species in Canada.

Little is known about herpesviruses in Canadian pinnipeds. We measured prevalence of antibodies to herpesviruses in the sera from Canadian phocid seals by an indirect enzyme-linked immunosorbent assay. Wild harbor seals (Phoca vitulina) and captive harbor seals were positive for antibodies to Phocid herpesvirus 1 (PhoHV-1) at prevalences of 91% and 100%, respectively. Sera from wild hooded seals (Cystophora cristata), harp seals (Pagophilus groenlandica), and grey seals (Halichoerus grypus) were positive for antibodies to PhoHV-1 antigenically related herpesvirus antigens at 73%, 79%, and 96%, respectively. We isolated new herpesviruses in cell culture from two hunter-harvested ringed seals (Pusa hispida) in poor body condition from Ulukhaktok, Northwest Territories, Canada; one lethargic hooded seal from the St. Lawrence Estuary, Québec, Canada; and one captive, asymptomatic harp seal from the Magdalen Islands, Québec. Partial sequencing of the herpesvirus DNA polymerase gene revealed that all four virus isolates were closely related to PhoHV-2, a member of the Gammaherpesvirinae subfamily, with nucleotide similarity ranging between 92.8% and 95.3%. The new seal herpesviruses were genetically related to other known pinniped herpesviruses, such as PhoHV-1, Otariid herpesvirus 3, Hawaiian monk (Monachus schauinslandi) seal herpesvirus, and Phocid herpesvirus 5 with 47–48%, 55%, 77%, and 70–77% nucleotide similarities, respectively. The harp seal herpesvirus and both ringed seal herpesviruses were almost identical to each other, whereas the hooded seal herpesvirus was genetically different from the three others (92.8% nucleotide similarity), indicating detection of at least two novel seal herpesviruses. These findings are the first isolation, partial genome sequencing, and identification of seal gammaherpesviruses in three species of Canadian phocid seals; two species of which were suspected of exposure to one or more antigenically related herpesviruses based on serologic analyses.

Isolation and Characterization of Agglutinin in the Hemolymph of Penaeus indicus H. Milne Edwards

The present study is an attempt to find out the ralation between RNA/DNA ratio, protein,percentage growth rate and specific growth rate of prawn,Penaeus indicus with respect to Nervous system, Eyestalk and Muscle tissues during ontogenesis. We have isolated and purified a natural agglutinin in the hemolymph of P.indicus with antigenecity, agglutinating, hemolytic and antibacterial properties. The influence of growth and environmental parameters on the level of agglutinin in the hemolymph was studied. Agglutinin concentration during normal growth process was compared. The agglutinin concentration in the hemolymph was quantified through developing ELISA, which is useful in health monitoring studies of individual species. Complete amino acid composition of both the subunits of P.indicus agglutinin were analysed. P.indicus agglutinin showed similarity to those proteins having antigenecity,hemolytic and agglutinating properties.Hence, agglutinin was considered as a natural defence protein in the hemolymph of P.indicus responsible for immune surveillance. The humoral defence mechanism of agglutinin was a co-operative effort with hemocytes and complement system. The composition of isolated agglutinin of P.indicus amino acids will be helpful in the synthesis of new antibacterial analogues which can be used against disease causing organisms.