983 resultados para Cell Expansion
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Dendritic cells (DC) are potent APCs that enter resting tissues as precursors and, after Ag exposure, differentiate and migrate to draining lymph nodes. The phenotype of RelB knockout mice implicates this member of the NF kappa B/Rel family in DC differentiation. To further elucidate the role of RelB in DC differentiation, mRNA, intracellular protein expression, and DNA binding activity of RelB were examined in immature and differentiated human DC, as well as other PB mononuclear cell populations. RelB protein and mRNA were detected constitutively in lymphocytes and in activated monocytes, differentiated DC, and monocyte-derived DC. Immunohistochemical staining demonstrated RelB within the differentiated lymph node interdigitating DC and follicular DC, but not undifferentiated DC in normal skin. Active nuclear RelB was detected by supershift assay only in differentiated DC derived from either PB precursors or monocytes and in activated B cells. These RelB+ APC were potent stimulators of the MLR. The data indicate that RelB expression is regulated both transcriptionally and post-translationally in myeloid cells. Within the nucleus, RelB may specifically transactivate genes that are critical for APC function.
Resumo:
Sickle-cell disease is the most prevalent genetic disease in the Brazilian population. Lower limb ulcers are the most frequent cutaneous complications, affecting 8% to 10% of the patients. These ulcers are usually deep and may take many years to heal. Evidence about the effectiveness of systemic or topical treatment of these wounds is limited, apart from stabilization of the anemia. A 28-year old woman with sickle-cell disease was admitted for treatment of three deep chronic lower leg ulcers. All wounds had tendon exposure and contained firmly adherent fibrin slough. Following surgical debridement and before grafting, the wounds were managed with three different dressings: a rayon and normal saline solution dressing, a calcium alginate dressing covered with gauze, and negative pressure therapy. All three wounds healed successfully and their grafts showed complete integration; only the rayon-dressed wound required a second debridement. The alginate and rayon-dressed wounds recurred after 9 months and required additional skin grafts. Helpful research on managing ulcers in patients with sickle-cell disease is minimal, but the results of this case study suggest that topical treatment modalities may affect outcomes. Research to explore the safety and effectiveness of NPT in patients with sickle-cell wounds is warranted.
Resumo:
Objectives: To evaluate p63 expression in laryngeal squamous cell carcinoma and its prognostic significance. Methods: p63 expression was examined by immunohistochemistry and scored in 127 patients with laryngeal squamous cell carcinomas. Results: Sixty-two cases had scored 3, sixty had scored 2, four had scored 1 and one case did not show any expression (48.8, 47.2, 3.1 and 0.8%, respectively). Overall survival was 73.9% at 24 months and 59.5% at 60 months. The disease-free survival was 77.2 and 75.1%, and the disease-specific survival was 79 and 67% at 24 and 60 months, respectively. Uni- and multivariate analysis identified that decreased immunoexpression of protein p63 was a statistically significant factor for the risk of recurrence and death by cancer. Conclusions: p63 expression was highly prevalent in laryngeal squamous cell carcinomas, and its underexpression was correlated with a worse prognosis. Copyright (C) 2010 S. Karger AG, Basel
Resumo:
Background: The use of springs in cranial expansion has demonstrated to be effective for craniosynostosis treatment. The spring-exerted expansile action has been observed when springs are placed both in the sagittal and parasagittal regions, mainly in scaphocephaly. In this study, a variation in cephalometric measurements under expansible spring action on the skull base was analyzed. Methods: Thirteen 4-week-old New Zealand white rabbits were divided into 4 groups: group 1, in which only amalgam markers were used (control); group 2, in which amalgam markers were used, and a sagittal suturectomy was performed; group 3, in which amalgam markers were used, and a sagittal suturectomy was performed with placement of expansible springs in the interparietal region; and group 4, in which markers were used, and a linear parasagittal craniectomy was performed with spring placement. All animals were killed at weeks 2, 4, 8, and 12. Radiologic control with cephalometric study was performed. Results: Distraction of amalgam markers in the groups with springs was greater than in those without springs. A proportional change in the angles measured through craniometry was observed in these groups. Conclusions: The experimental rabbit model was shown to be adequate to the analysis proposed by the study. Under the action of springs, the groups with sagittal and parasagittal osteotomy were found to present a similar distraction of amalgam markers. A concomitant change in cephalometric measurements occurred, suggesting a change in the skull base mediated by expansible springs placed both in the sutural and nonsutural sites.
Resumo:
Objective. The objective of this study was to evaluate, using computed tomography, correlations between Hyrax appliance opening and post-SARPE skeletal changes. Study design. Fifteen patients underwent SARPE according to a specific protocol and were followed. Linear and angular measurements of the anterior, intermediate, and posterior portions of the maxilla were evaluated. The correlation between maxillary expansion and appliance opening was investigated. Results. Significant overall expansion was observed. In the anterior and intermediate portions of the maxilla, the increase in maxillary width was greater than that observed in the posterior portion. The degree of appliance opening was significantly greater than that of the skeletal expansion. Also, no linear correlation between appliance opening and regional maxillary expansion was established. Conclusion. The transverse expansion of the maxilla was less than uniform. The lack of linear correlation between appliance opening and skeletal expansion is attributable to multiple factors, including those related to the device, the surgical technique, and the craniofacial deformity itself. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008; 106: 812-819)
Resumo:
A distinct type of cellular organization was found in two species of the planctomycete genus Pirellula, Pirellula marina and Pirellula staleyi. Both species possess two distinct regions within the cell which are separated by a single membrane. The major region of the cell, the pirellulosome, contains the fibrillar condensed nucleoid. The other area, the polar cap region, forms a continuous layer surrounding the entire pirellulosome and displays a cap of asymmetrically distributed material at one cell pole. Immuno- and cytochemical-labelling of P. marina demonstrated that DNA is located exclusively within the pirellulosome; cell RNA is concentrated in the pirellulosome, with some RNA also located in the polar cap region.
Resumo:
The longest open reading frame of PKHD1 (polycystic kidney and hepatic disease 1), the autosomal recessive polycystic kidney disease (ARPKD) gene, encodes a single-pass, integral membrane protein named polyductin or fibrocystin. A fusion protein comprising its intracellular C-terminus, FP2, was previously used to raise a polyclonal antiserum shown to detect polyductin in several human tissues, including liver. In the current study, we aimed to investigate by immunohistochemistry the detailed polyductin localization pattern in normal (ductal plate [DP], remodelling ductal plate [RDP], remodelled bile ducts) and abnormal development of the primitive intrahepatic biliary system, known as ductal plate malformation (DPM). This work also included the characterization of polyductin expression profile in various histological forms of neonatal and infantile cholestasis, and in cholangiocellular carcinoma (CCC) and hepatocellular carcinoma (HCC). We detected polyductin expression in the intrahepatic biliary system during the DP and the RDP stages as well as in DPM. No specific staining was found at the stage of remodelled bile ducts. Polyductin was also detected in liver biopsies with neonatal cholestasis, including mainly biliary atresia and neonatal hepatitis with ductular reaction as well as congenital hepatic fibrosis. In addition, polyductin was present in CCC, whereas it was absent in HCC. Polyductin was also co-localized in some DP cells together with oval stem cell markers. These results represent the first systematic study of polyductin expression in human pathologies associated with abnormal development of intrahepatic biliary tree, and support the following conclusions: (i) polyductin expression mirrors developmental properties of the primitive intrahepatic biliary system; (ii) polyductin is re-expressed in pathological conditions associated with DPM and (iii) polyductin might be a potential marker to distinguish CCC from HCC.
Resumo:
A total of 53 patients aged 18-60 years with highintermediate or high-risk diffuse large B-cell lymphoma (DLBCL) were evaluated to analyze the impact of the cell of origin. Of 53 patients, 16 underwent autologous SCT (ASCT) in first remission and the rest received conventional chemotherapy. Immunohistochemistry was evaluated in 47 cases 17 were of germinal center (GC) origin and 30 were of non-GC origin. There was no survival difference between the two groups. Overall survival (OS) and disease-free survival (DFS) at 3 years were 93 and 83%, respectively, for the 14 patients who underwent ASCT. Their DFS was significantly better than that of patients who achieved CR but did not undergo ASCT. We conclude that ASCT is safe and improves the DFS of high-intermediate and high-risk DLBCL, regardless of the cell of origin. This observation should be confirmed in a larger study.
Resumo:
Background: p63 gene is a p53 homologue that encodes proteins with transactivation, DNA-binding and tetramerisation domains. The isoforms TAp63 and TAp73 transactivate p53 target genes and induce apoptosis, whereas the isoforms Delta Np63 and Delta Np73 lack transactivation and might have dominant-negative effects in p53 family members. p63 is expressed in germinal centre lymphocytes and can be related to the development of the lymphoma, but the prognostic significance of its expression in the survival of patients with diffuse large B-cell lymphoma (DLBCL) remains unclear. Aims: To determine whether quantitative immunohistochemical (IHC) analysis of p63 protein expression correlates with CD10 antigen, Bcl-6 antigen and IRF4 antigen expression and to determine whether p63 is a surrogate predictor of overall survival in high-intermediate and high risk DLBCL populations. Methods: CD10, Bcl-6 and IRF4 expression were retrospectively evaluated by IHC in 73 samples of high intermediate and high risk DLBCL and were used to divide the lymphomas into subgroups of germinal centre B-celllike (GCB) and activate B-cell-like (ABC) DLBCL. Similarly, p63 expression was evaluated by IHC and the results were compared with subgroups of DLBCL origin and with the survival rates for these patients. Results: p63 was expressed in more than 50% of malignant cells in 11 patients and did not show correlation with subgroups of GCB-like DLBCL or ABC-like DLBCL, but p63(+) patients had better disease-free survival (DFS) than those who were negative (p = 0.01). Conclusions: p63(+) high-intermediate and high risk DLBCL patients have a better DFS than negative cases.
Resumo:
We reviewed the data of 307 patients treated with autologous bone marrow transplantation with the aim to identify factors associated with poor hematopoietic stern cell (HSC) mobilization after administration of cyclophosphamide and granulocyte-colony stimulating factor. Success in mobilization was defined when >= 2.0 x 10(6) CD34+ cells/kg weight could be collected with <= 3 leukapheresis procedures. Success was observed in 260 patients (84.7%) and nonsuccess in 47 patients (15.3%). According to the stepwise regression model: diagnosis, chemotherapy load, treatment with mitoxantrone and platelet count before mobilization were found to be independent predictive factors for HSC mobilization. These results could help in the previous recognition of patients at risk for non response to mobilization and allow to plan an alternative protocol for this group of patients. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
Objective. To assess the testicular Sertoli cell function in male SLE patients. Methods. Thirty-four consecutive patients were prospectively selected to evaluate serum inhibin B. Clinical features, treatment, semen analysis, urological evaluation, testicular ultrasound, hormones and anti-sperm antibodies were determined. Results. Patients were subdivided into two groups: low serum inhibin B (Group 1, n = 8) and normal levels (Group 2, n 26). The median sperm concentration (P = 0.024), total sperm count (P = 0.023) and total motile sperm count (P = 0.025) were lower in Group 1. Inhibin B levels were positively correlated with sperm concentration (r = 0.343), total motile sperm count (r = 0.357), and negatively correlated with follicule-stimulating hormone (FSH) (r = 0.699) and luteinizing hormone (r = 0.397). The median serum inhibin B was lower in SLE patients treated with intravenous cyclophosphamide (IVCYC) compared with those without this therapy (P = 0.031). Further evaluation of the 26 SLE patients with normal inhibin B and FSH levels revealed that medians of inhibin B/FSH ratio were lower in SLE patients with oligozoospermia compared with normozoospermia (P = 0.004). This ratio was also lower in SLE patients treated with IVCYC than those without this therapy (P = 0.04). In contrast, inhibin B serum level alone did not discriminate the later group of patients (P = 0.12). Conclusions. This is the first study to identify a high frequency of testicular Sertoli cell dysfunction in male SLE associated with semen abnormalities. Further prospective studies are necessary to determine if inhibin levels and inhibin B/FSH ratio will be an earlier and useful marker of IVCYC toxicity in these patients.
Resumo:
Sm14 and paramyosin are two major Schistosoma mansoni vaccine candidate antigens. Recently, we have identified Sm14 and paramyosin epitopes that are recognized by T cells of resistant individuals living in endemic areas for schistosomiasis. Herein, mice were immunized with these peptides separately or in association in order to evaluate their vaccine potential. Immunization of mice with Sm14 peptides alone or mixed with paramyosin peptides was able to induce 26%-36.7% or 28%-29.2% of worm burden reduction, 67% or 46% of intestinal eggs reduction and also 54%-61% or 43%-52% of liver pathology reduction, respectively. Protection was associated with a Th1 type of immune response induced by Sm14 peptide immunization. In contrast, paramyosin peptide vaccination did not engender protective immunity or liver pathology reduction and immunization was associated with a Th2 type of immune response. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
Sepsis induces a systemic inflammatory response leading to tissue damage and cell death. LPS tolerance affects inflammatory response. To comprehend potential new mechanisms of immune regulation in endotoxemia, we examined macrophage mRNA expression by macroarray affected by LPS tolerance. LPS tolerance was induced with subcutaneous administration of 1 mg/kg/day of LPS over 5 days. Macrophages were isolated from the spleen and the expression of 1200 genes was quantitatively analyzed by the macroarray technique. The tolerant group displayed relevant changes in the expression of 84 mRNA when compared to naive mice. A functional group of genes related to cell death regulation was identified. PARP-1, caspase 3, FASL and TRAIL genes were confirmed by RT-PCR to present lower expression in tolerant mice. In addition, reduced expression of the pro-inflammatory genes TNF-alpha and IFN-gamma in the tolerant group was demonstrated. Following this, animals were challenged with polymicrobial sepsis. Flow cytometry analysis showed reduced necrosis and apoptosis in macrophages from the tolerant group compared to the naive group. Finally, a survival study showed a significant reduction in mortality in the tolerant group. Thus, in the current study we provide evidence for the selective reprogramming of the gene expression of cell death pathways during LPS tolerance and link these changes to protection from cell death and enhanced survival rates. (C) 2010 Elsevier Ltd. All rights reserved.