TRPV1 Channels Contribute to Behavioral Hypersensitivity and Spontaneous Activity in Nociceptors After Spinal Cord Injury

A majority of persons who have sustained spinal cord injury (SCI) develop chronic pain. While most investigators have assumed that the critical mechanisms underlying neuropathic pain after SCI are restricted to the central nervous system (CNS), recent studies showed that contusive SCI results in a large increase in spontaneous activity in primary nociceptors, which is correlated significantly with mechanical allodynia and thermal hyperalgesia. Upregulation of ion channel transient receptor vanilloid 1 (TRPV1) has been observed in the dorsal horn of the spinal cord after SCI, and reduction of SCI-induced hyperalgesia by a TRPV1 antagonist has been claimed. However, the possibility that SCI enhances TRPV1 expression and function in nociceptors has not been tested. I produced contusive SCI at thoracic level T10 in adult, male rats and harvested lumbar (L4/L5) dorsal root ganglia (DRG) from sham-treated and SCI rats 3 days and 1 month after injury, as well as from age-matched naive control rats. Whole-cell patch clamp recordings were made from small (soma diameter <30 >μm) DRG neurons 18 hours after dissociation. Capsaicin-induced currents were significantly increased 1 month, but not 3 days, after SCI compared to neurons from control animals. In addition, Ca2+ transients imaged during capsaicin application were significantly greater 1 month after SCI. Western blot experiments indicated that expression of TRPV1 protein in DRG is also increased 1 month after SCI. A major role for TRPV1 channels in pain-related behavior was indicated by the ability of a specific TRPV1 antagonist, AMG9810, to reverse SCI-induced hypersensitivity of hindlimb withdrawal responses to heat and mechanical stimuli. Similar reversal of behavioral hypersensitivity was induced by intrathecal delivery of oligodeoxynucleotides antisense to TRPV1, which knocked down TRPV1 protein and reduced capsaicin-evoked currents. TRPV1 knockdown also decreased the incidence of spontaneous activity in dissociated nociceptors after SCI. Limited activation of TRPV1 was found to induce prolonged repetitive firing without accommodation or desensitization, and this effect was enhanced by SCI. These data suggest that SCI enhances TRPV1 expression and function in primary nociceptors, increasing the excitability and spontaneous activity of these neurons, thus contributing to chronic pain after SCI.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

G -rich oligodeoxyribonucleotides: Triplexes and transcription

Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^

Aberrant regulation of the Src -FAK signaling pathway in the human colon adenocarcinoma cell line HT-29

c-Src, a protein tyrosine kinase (PTK) the specific activity of which is increased $>$20-fold in $\sim$80% of colon tumors and colon tumor cell lines, plays a role in both growth regulation and tumorigenicity of colon tumor cells. To examine the effect of increased c-Src specific activity on colon tumor cells, coumarin-derived tyrosine analog PTK inhibitors were assessed in a standard colon tumor cell line, HT-29. Of the nine compounds tested for inhibiting c-Src activity in a standard immune complex kinase assay from c-Src precipitated from HT-29 cells, the 7,8-dihydroxy-containing compounds daphnetin and fraxetin were most effective, with IC$\sb{50}$s of 0.6 $\pm$ 0.2 mM and 0.6 $\pm$ 0.3 mM, respectively. Treatment of HT-29 cells with daphnetin resulted in inhibition of cell growth in a dose-dependent manner. In contrast, scopoletin, a relatively poor Src inhibitor in vitro, did not inhibit HT-29 cell growth in the concentration range tested. In daphnetin treated cells, a dose-dependent decrease of c-Src activity paralleling cell growth inhibition was also observed; the IC$\sb{50}$ was 0.3 $\pm$ 0.1 mM for c-Src autophosphorylation. In contrast, the IC$\sb{50}$ for c-Src protein level was $>$ 0.6 mM, indicating that the effects of daphnetin were primarily an enzymatic activity of c-Src, rather than protein level in HT-29 cells. These results are the first to demonstrate that c-Src specific activity regulates colon tumor cell growth.^ To elucidate the signaling pathways activated by c-Src in colon tumor cells, the Src family substrate FAK, which has been shown to play a role in both extracellular matrix-dependent cell growth and survival, was examined. Coprecipitation assays showed Src-FAK association in detergent insoluble fractions of both attached and detached HT-29 cells, indicating that Src-FAK association in HT-29 cells is stable and, unlike untransformed cells, not dependent on cell-substratum contact. FAK also coprecipitated with Grb2, an adaptor protein also playing a role in cell proliferation and survival, in both attached and detached HT-29 cells, suggesting that a Src-FAK-Grb2-mediated signaling pathway(s) in HT-29 cells is/are constitutively activated.^ FAK was also analyzed in c-src antisense HT-29 clones AS15 and AS33 in which c-Src is specifically reduced by transfection of an antisense expression vector. FAK protein level is unexpectedly decreased in both AS15 and AS33 cells by 5-fold and 1.5-fold compared to HT-29, respectively, corresponding with the decreased expression of c-Src observed in these cells. FAK protein level was not decreased compared to parental in the c-src "sense" clone S8. Northern blot analyses showed decreased FAK mRNA levels compared to parental in AS15 and AS33, correlating with decreased FAK protein level, indicating that FAK activity in the antisense cells is regulated, at least in part, by altering FAK expression, and that this regulation is Src dependent. Because FAK has been implicated in anoikis, the ability of c-src antisense cells to survive in the absence of cell-substratum contact was examined. Decreased cell survival is seen in both AS15 and AS33, correlating with the decreases in c-Src and FAK levels and tumorigenicity in these cells. These results suggest that at least one mechanism by which activation of c-Src contributes to tumorigenic phenotype of colon tumor cells is by aberrantly promoting a survival signal through unregulated Src-FAK-Grb2 complexes. (Abstract shortened by UMI.) ^

The antiapoptotic effect of overexpression c -erBb2 in breast cancer

Overexpression of the receptor tyrosine kinase p185ErbB2 confers taxol resistance in breast cancers and activation of p34Cdc2 is required for taxol-induced apoptosis and cytotoxicity. Here, we investigated the underlying mechanisms and found that overexpression of p185 ErbB2 inhibits taxol-induced apoptosis through two branches to inhibit activation of p34Cdc2. ^ Overexpression of p185ErbB2 in MDA-MB-435 cells by transfection transcriptionally upregulated p21Cip1, which associates with p34Cdc2, inhibits taxol-mediated p34Cdc2 activation, delays cell entrance to G2/M phase, and thereby inhibits taxol-induced apoptosis. In p21Cip1 antisense-transfected MDA-MB-435 cells or in p21−/− MEF cells, p185ErbB2 was unable to inhibit taxol-induced apoptosis. Therefore, p21Cip1 participates in the regulation of a G2/M checkpoint that contributes to resistance to taxol-induced apoptosis in p185ErbB2-overexpressing breast cancer cells. ^ Direct phosphorylation on Tyrosine-15 of p34Cdc2 by p185 ErbB2 receptor tyrosine kinase inhibits p34Cdc2 activation. The wild-type p185ErbB2 but not the kinase-defective mutant, when overexpressed in breast cancer cells, can phosphorylate p34Cdc2 on tyrosine (Tyr)15, an inhibitory phosphorylation site of p34 Cdc2. The kinase domain of the ErbB2 receptor was sufficient for binding to p34Cdc2 and directly phosphorylating the recombinant Cdc2. Phosphospecific Cdc2-Tyr15 immunoblot analyses, immunocomplex kinase assays, and phospho-amino acid analyses revealed that p185ErbB2 specifically phosphorylates Cdc2 on Tyr15. Phosphorylation of Cdc2-Tyr15 by ErbB2 is modulated during cell cycle and corresponded with delayed cell entry into G2/M phase. The kinase-defective p185ErbB2, which incapable of phosphorylating Cdc2-Tyr15, failed to inhibit taxol-induced activation and apoptosis, whereas the wild-type and the constitutive-active p185ErbB2 did. Increased Cdc2-Tyr15 phosphorylation was found in Erb132-overexpressing tumors from breast cancer patients. Thus, direct phosphorylation of Cdc2-Tyr15 by p185 ErbB2 RTK in breast cancer cells inhibits taxol-induced p34 Cdc2 activation and apoptosis, thereby conferring taxol resistance. ^

The role of Ski/Sno oncoproteins as negative regulators of the TGF-beta/SMAD signaling pathway in B -cell non -Hodgkin's lymphoma (NHL-B)

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Identification and characterization of the vegetally localized Hermes mRNA

One way developing embryos regulate the expression of their genes is by localizing mRNAs to specific subcellular regions. In the oocyte of the frog, Xenopus laevis, many RNAs are localized specifically to the animal or the vegetal halves of the oocyte. The localization of these RNAs contributes to the primary polarity of the oocyte, the asymmetry that is the basis for patterning and lineage specification in the embryo. I have screened a cDNA library for clones containing the Xlsirt repeat, an element known to target RNAs to the vegetal cortex of the oocyte. I have identified seventeen cDNA clones that contain this element. One of these cDNAs encodes the RNA binding protein Hermes. The Hermes mRNA is localized to the vegetal cortex of the oocyte. Additionally, Hermes protein is also vegetally localized in the oocyte and is found in subcellular structures known to contain localized mRNAs. This suggests that Hermes might interact with localized RNAs. While Hermes protein is present in oocytes, it disappears at germinal vesicle breakdown during maturation. We therefore believe that the time period during which Hermes functions is during oogenesis or maturation prior to the time of Hermes degradation. To determine Hermes function, an antisense depletion strategy was used that involved injecting morpholino oligos (HE-MO) into oocytes. Injection of these morpholinos causes the level of Hennes protein to drop prematurely during maturation. Embryos produced from these oocytes exhibit cleavage defects that are most prevalent in the vegetal blastomeres. The phenotype can be partially rescued by injection of a heterologous Hermes mRNA and is therefore specific to Hermes. The Hermes expression and depletion results are consistent with a model in which Hermes interacts with one or more vegetally localized mRNAs in the oocyte and during the early stages of maturation. The interaction is required for cleavage of the vegetal blastomeres. Therefore, it is likely that at least one mRNA that interacts with Hermes is a cell cycle regulator. ^

Molecular mechanism of the relaxin signaling pathways: Activation of cAMP, PI3K, and PKCzeta

Relaxin is a polypeptide hormone that has diverse effects on reproductive and non-reproductive tissues. Relaxin activates the G-protein coupled receptors, LGR7 and LRG8. Early studies described increased cAMP and protein kinase A activity upon relaxin treatment, but cAMP accumulation alone could not account for all of the relaxin-mediated effects. We utilized the human monocyte cell line THP-1 to study the mechanism of relaxin-stimulated CAMP production. ^ Relaxin treatment in THP-1 cells produces a biphasic time course in cAMP accumulation, where the first peak appears as early as 1–2 minutes with a second peak at 10–20 minutes. Selective inhibitors for phosphoinositide 3-kinase (P13K), such as wortmannin and LY294002, show a dose-dependent inhibition of relaxin-stimulated cAMP accumulation, specific for the second peak of the relaxin time course. Neither the effects of relaxin nor the inhibition of relaxin by LY294002 is mediated by the activity of phosphodiesterases. Furthermore, LY294002 blocks upregulation of vascular endothelial growth factor transcript levels by relaxin. ^ To further delineate relaxin signaling pathways, we searched for downstream targets of PI3K that could activate adenylyl cyclase (AC). Protein kinase C ζ (PKCζ) was a prime candidate because it activates types II and V AC. Chelerythrine chloride (a general PKC inhibitor) inhibits relaxin-induced cAMP production to the same degree as LY294002 (∼40%). Relaxin stimulates PKCζ translocation to the plasma membrane in THP-1, MCF-7, PHM1-31, and MMC cells, as shown by immunocytochemistry. PKCζ translocation is P13K-dependent and independent of cAMP production. Antisense PKCζ oligodeoxynucleotides (PKCζ-ODNs) deplete both PKCζ transcript and protein levels in THP-1 cells. PKCζ-ODNs abolish relaxin-mediated PKCζ translocation and inhibit relaxin stimulation of cAMP by 40%, as compared to mock and random ODN controls. Treatment with LY294002 in the presence of PKCζ-ODNs results in little further inhibition. Taken together, we present a novel role for PI3K and PKCζ in relaxin stimulation of cAMP and provide the first example of the PKCζ regulation of AC in an endogenous system. Furthermore, we have identified higher order complexes of AC isoforms and PKA anchoring proteins in attempts to explain the differential coupling of relaxin to cAMP and PI3K-signaling pathways in various cell types. ^

Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium

This volume contains the Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium held at Kansas State University on September 21, 1996. The program included 10 oral presentations and 14 posters. Some of the papers describe the progress of ongoing projects, and others contain the results of completed projects. Only brief summaries are given of some of the papers; many of the papers will be published in full elsewhere. A listing of those who attended is given below. ContentsForeign Protein Production from SV40 Early Promoter in Continuous Cultures of Recombinant CHO Cells - Gautam Banik, Paul Todd, and Dhinakar Kampala Enhanced Cell Recruitment Due to Cell-Cell Interactions - Brad Farlow and Matthias Nollert The Recirculation of Hybridoma Suspension Cultures: Effects on Cell Death, Metabolism and Mab Productivity - Peng Jin and Carole A. Heath The Importance of Enzyme Inactivation and Self-Recovery in Cometabolic Biodegradation of Chlorinated Solvents - Xi-Hui Zhang, Shanka Banerji, and Rakesh Bajpai Phytoremediation of VOC contaminated Groundwater using Poplar Trees - Melissa Miller, Jason Dana, L.C. Davis, Murlidharan Narayanan, and L.E. Erickson Biological Treatment of Off-Gases from Aluminum Can Production: Experimental Results and Mathematical Modeling - Adeyma Y. Arroyo, Julio Zimbron, and Kenneth F. Reardon Inertial Migration Based Separation of Chlorella Microalgae in Branched Tubes - N.M. Poflee, A.L. Rakow, D.S. Dandy, M.L. Chappell, and M.N. Pons Contribution of Electrochemical Charge to Protein Partitioning in Aqueous Two-Phase Systems - Weiyu Fan and Charles C. Glatz Biodegradation of Some Commercial Surfactants Used in Bioremediation - Jun Gu, G.W. Preckshot, S.K. Banerji, and Rakesh Bajpai Modeling the Role of Biomass in Heavy Metal Transport Ln Vadose Zone - K.V. Nedunuri, L.E. Erickson, and R.S. Govindaraju Multivariable Statistical Methods for Monitoring Process Quality: Application to Bioinsecticide Production by 73 89 Bacillus Thuringiensis - c. Puente and M.N. Karim The Use of Polymeric Flocculants in Bacterial Lysate Streams - H. Graham, A.S. Cibulskas and E.H. Dunlop Effect of Water Content on transport of Trichloroethylene in a Chamber with Alfalfa Plants - Muralidharan Narayanan, Jiang Hu, Lawrence C. Davis, and Larry E. Erickson Detection of Specific Microorganisms using the Arbitrary Primed PCR in the Bacterial Community of Vegetated Soil - X. Wu and L.C. Davis Flux Enhancement Using Backpulsing - V.T. Kuberkar and R.H. Davis Chromatographic Purification of Oligonucleotides: Comparison with Electrophoresis - Stephen P. Cape, Ching-Yuan Lee, Kevin Petrini, Sean Foree, Micheal G. Sportiello and Paul Todd Determining Singular Arc Control Policies for Bioreactor Systems Using a Modified Iterative Dynamic Programming Algorithm - Arun Tholudur and W. Fred Ramirez Pressure Effect on Subtilisins Measured via FTIR, EPR and Activity Assays, and Its Impact on Crystallizations - J.N. Webb, R.Y. Waghmare, M.G. Bindewald, T.W. Randolph, J.F. Carpenter, C.E. Glatz Intercellular Calcium Changes in Endothelial Cells Exposed to Flow - Laura Worthen and Matthias Nollert Application of Liquid-Liquid Extraction in Propionic Acid Fermentation - Zhong Gu, Bonita A. Glatz, and Charles E. Glatz Purification of Recombinant T4 Lysozyme from E. Coli: Ion-Exchange Chromatography - Weiyu Fan, Matt L. Thatcher, and Charles E. Glatz Recovery and Purification of Recombinant Beta-Glucuronidase from Transgenic Corn - Ann R. Kusnadi, Roque Evangelista, Zivko L. Nikolov, and John Howard Effects of Auxins and cytokinins on Formation of Catharanthus Roseus G. Don Multiple Shoots - Ying-Jin Yuan, Yu-Min Yang, Tsung-Ting Hu, and Jiang Hu Fate and Effect of Trichloroethylene as Nonaqueous Phase Liquid in Chambers with Alfalfa - Qizhi Zhang, Brent Goplen, Sara Vanderhoof, Lawrence c. Davis, and Larry E. Erickson Oxygen Transport and Mixing Considerations for Microcarrier Culture of Mammalian Cells in an Airlift Reactor - Sridhar Sunderam, Frederick R. Souder, and Marylee Southard Effects of Cyclic Shear Stress on Mammalian Cells under Laminar Flow Conditions: Apparatus and Methods - M.L. Rigney, M.H. Liew, and M.Z. Southard

Proceedings of the Twenty-Fifth Annual Biochemical Engineering Symposium

The Annual Biochemical Engineering Symposium Series started in 1970 when Professors Larry E. Erickson (Kansas State University) and Peter J. Reilly (then with University of Nebraska-Lincoln) got together in Manhattan, KS along with their students for a half-day powwow and technical presentation by their students. Ever since then, it has been a forum for Biochemical Engineering students in the heartland of USA to present their research to their colleagues in the form of talks and posters. The institutions actively involved with this annual symposium include Colorado State University, Kansas State University, Iowa State University, University of Colorado, University of Kansas, University of Missouri-Columbia, and University of Oklahoma. The University of lowa and University of Nebraska-Lincoln have also participated in the conference in recent years. The host institutions for the different symposia have been: Kansas State University (1, 3, 5, 9, 12, 16, 20), Iowa State University (6, 7, 10, 13, 17, 22), University of Missouri-Columbia (8, 14, 19, 25), Colorado State University (II, 15, 21), University of Colorado (18, 24), University of Nebraska-Lincoln (2, 4), University of Oklahoma (23). The next symposium will be held at Kansas State University. Proceedings of the Symposium are edited by faculty of the host institution and include manuscripts written and submitted by the presenters (students). These often include works-in-progress and final publication usually takes place in refereed journals. ContentsPatrick C. Gilcrease and Vincent G. Murphy, Colorado State University. Use of 2,4,6-Trinitrotoluene (TNT) As A Nitrogen Source By A Pseudomonas florescens Species Under Aerobic Conditions. Marulidharan Narayanan, Lawrence C. Davis, and Larry E. Erickson, Kansas State University. Biodegradation Studies of Chlorinated Organic Pollutants in a Chamber in the Presence of Alfalfa Plants. S.K. Santharam, L.E. Erickson, and L.T. Fan, Kansas State University.Surfactant-Enhanced Remediation of a Non-Aqueous Phase Contaminant in Soil. Barry Vant-Hull, Larry Gold, and Robert H. Davis, University of Colorado.The Binding of T7 RNA Polymerase to Double-Stranded RNA. Jeffrey A. Kern and Robert H. Davis, University of Colorado.Improvement of RNA Transcription Yield Using a Fed-Batch Enzyme Reactor. G. Szakacs, M. Pecs, J. Sipocz, I. Kaszas, S.R. Deecker, J.C. Linden, R.P. Tengerdy, Colorado State University.Bioprocessing of Sweet Sorghum With In Situ Produced Enzymes. Brad Forlow and Matthias Nollert, University of Oklahoma.The Effect of Shear Stress ad P-selectin Site Density on the Rolling Velocity of White Blood Cells. Martin C. Heller and Theodore W. Randolph, University of Colorado.The Effects of Plyethylene Glycol and Dextran on the Lyophilization of Human Hemoglobin. LaToya S. Jones and Theodore W. Randolph, University of Colorado.Purification of Recombinant Hepatitis B Vaccine: Effect of Virus/Surfactant Interactions. Ching-Yuan Lee, Michael G. Sportiello, Stephen Cape, Sean Ferree, Paul Todd, Craig E. Kundrot, and Cindy Barnes, University of Colorado.Application of Osmotic Dewatering to the Crystallization of Oligonucleotides for Crystallography. Xueou Deng, L.E. Erickson, and D.Y.C. Fung, Kansas State University.Production of Protein-Rich Beverages from Cheese Whey and Soybean by rapid Hydration Hydrothermal Cooking. Pedro M. Coutinho, Michael K. Dowd, and Peter J. Reilly, Iowa State University.Automated Docking of Glucoamylase Substrates and Inhibitors. J. Johansson and R.K. Bajpai, University of Missouri.Adsorption of Albumin on Polymeric Microporous Membranes.

Investigation of cell fate decision in Schizosaccharomyces pombe by ncRNA annotation and statistical analyses

Studies in the fission yeast Schizosaccharomyces pombe (S. pombe) have done much to inform the view of heterochromatin and its control by the RNA interference (RNAi) machinery. Using cDNA synthesised from poly(A)-enriched RNA samples, numerous novel ncRNA loci were discovered, and the 50 and 30 ends of many other genes were refined in previous studies. Although some of these transcripts may encode novel proteins the function of the majority is yet to be determined. The authors have used strand-specific deep sequencing of RNA, irrespective of poly(A) status, to reveal a highly structured antisense programme that modulates gene expression to dictate cell fate decisions during sexual differentiation. They show that an extensive and elaborate array of ncRNA production accompanies sexual differentiation in the fission yeast S. pombe. Experimental manipulation suggests that these transcripts specifically regulate the function of the target genes.

Microbial community composition in fresh water at different stations

Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes was used to investigate the phylogenetic composition of bacterioplankton communities in several freshwater and marine samples. An average of about 50% of the cells were detected by probes for the domains Bacteria and Archaea. Cells were concentrated from water samples (1 to 100 ml) on white polycarbonate filters (diameter, 47 mm; pore size, 0.2 mm; type GTTP 4700 [Millipore, Eschborn, Germany]) by applying a vacuum of <25 kPa. They were subsequently fixed by covering the filter with 3 ml of a freshly prepared, phosphate-buffered saline (pH 7.2)-4% paraformaldehyde (Sigma, Deisenhofen, Germany) solution for 30 min at room temperature. Airdried filters are ready for hybridization and can be stored at 220°C or room temperature for several months without showing apparent changes. Probes BET42a, GAM42a, and PLA886 were used with competitor oligonucleotides as described previously amongst others in Manz et al., (1992; doi:10.1016/S0723-2020(11)80121-9). The filters were transferred to a vial containing 50 ml of prewarmed (48°C) washing solution (70 mM NaCl, 20 mM Tris-HCl [pH 7.4], 5 mM EDTA, 0.01% sodium dodecyl sulfate) and incubated freely floating without shaking at 48°C for 15 min. The filter sections were dried on Whatman 3M paper (Whatman Ltd., Maidstone, United Kingdom) and covered with 50 ml of DAPI solution (1 mg/ml in distilled water filtered through at 0.2-mm filter) for 5 min at room temperature in the dark. For each sample and probe, more than 500 cells were enumerated; for the DAPI examination, more than 1,500 cells were counted per sample. All probe-specific cell counts are presented as the percentage of cells visualized by DAPI. The mean abundances and standard deviations were calculated from the counts of 10 to 20 randomly chosen fields on each filter section. All counts were corrected by subtracting the counts obtained with the negative control NON338. Mean and standard deviation were calculated from the counts of 10 to 20 randomly chosen fields on each filter section.

Chemical analysis and Microbial community composition of surface water samples from the Southern Lagoon of Venice

The Lagoon of Venice is a large water basin that exchanges water with the Northern Adriatic Sea through three large inlets. We examined two adjacent sites within the Southern Basin and at the Chioggia inlet in autumn 2007 and summer 2008. A pilot study in June 2007 on a surface water sample from Chioggia with a rather high salinity of 36.9 PSU had revealed a conspicuous bloom of CF319a-positive cells likely affiliated with the Cytophaga /Flavobacteria cluster of Bacteroidetes. These flavobacterial abundances were one to two orders of magnitude higher than in other marine surface waters. DAPI-stained cells were identified as bacteria with the general bacterial probe mixture EUB338 I-III. CARD-FISH counts with group-specific probes confirmed the dominance of Bacteroidetes (CF319a), Alphaproteobacteria (ALF968), and Gammaproteobacteria (GAM42a). CARD-FISH showed thatBetaproteobacteria and Planctomycetes were minor components of the bacterioplankton in the Lagoon of Venice.

Chloroflexus spp. and Sulfurihydrogenibium spp. in microbial mats of the Nakabusa hot spring, Japan

Microbial mats develop in a wide range of aquatic habitats, such as geothermal hot springs, hypersaline ponds, marine cold seeps or hydrothermal vents. The Nakabusa hot spring is located in the Nagano Prefecture, Japan (36.3875N, 137.75E), dense olive-green microbial mats develop in regions where the slightly alkaline, sulfidic effluent has cooled to 65°C. The microbial community of such mats was analyzed by focusing on the diversity, as well as the in situ distribution and function of bacteria involved in sulfur cycling. Microbial mat samples were kept in sterile plastic tubes (for molecular analysis) or glass bottles completely filled with hot spring water to avoid oxidation. Samples were transferred to the laboratory on ice and used for physiological experiments within 8h. Quantification of cell biovolumes was carried out based on images of mat sections hybridized with Sulfurihydrogenibium- and Chloroflexi-specific probes, and stained with DAPI. In situ hybridizations (CARD-FISH) of thin matsections showed a heterogeneous vertical distribution of Sulfurihydrogenibium and Chloroflexus. Sulfurihydrogenibium dominated near the mat surface (50% of the total mat biovolume), while Chloroflexus dominated in deeper layers (up to 64% of the total mat biovolume).