909 resultados para 070301 Agro-ecosystem Function and Prediction


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

It has long been known that amino acids are the building blocks for proteins and govern their folding into specific three-dimensional structures. However, the details of this process are still unknown and represent one of the main problems in structural bioinformatics, which is a highly active research area with the focus on the prediction of three-dimensional structure and its relationship to protein function. The protein structure prediction procedure encompasses several different steps from searches and analyses of sequences and structures, through sequence alignment to the creation of the structural model. Careful evaluation and analysis ultimately results in a hypothetical structure, which can be used to study biological phenomena in, for example, research at the molecular level, biotechnology and especially in drug discovery and development. In this thesis, the structures of five proteins were modeled with templatebased methods, which use proteins with known structures (templates) to model related or structurally similar proteins. The resulting models were an important asset for the interpretation and explanation of biological phenomena, such as amino acids and interaction networks that are essential for the function and/or ligand specificity of the studied proteins. The five proteins represent different case studies with their own challenges like varying template availability, which resulted in a different structure prediction process. This thesis presents the techniques and considerations, which should be taken into account in the modeling procedure to overcome limitations and produce a hypothetical and reliable three-dimensional structure. As each project shows, the reliability is highly dependent on the extensive incorporation of experimental data or known literature and, although experimental verification of in silico results is always desirable to increase the reliability, the presented projects show that also the experimental studies can greatly benefit from structural models. With the help of in silico studies, the experiments can be targeted and precisely designed, thereby saving both money and time. As the programs used in structural bioinformatics are constantly improved and the range of templates increases through structural genomics efforts, the mutual benefits between in silico and experimental studies become even more prominent. Hence, reliable models for protein three-dimensional structures achieved through careful planning and thoughtful executions are, and will continue to be, valuable and indispensable sources for structural information to be combined with functional data.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le récepteur DcR3 (Decoy receptor 3) est un membre de la famille des récepteurs aux facteurs de nécrose tumorale (TNF). Il est fortement exprimé dans les tissus humains normaux ainsi que les tumeurs malignes. DcR3 est un récepteur pour trois ligands de la famille du TNF tels que FasL, LIGHT et TL1A. Étant une protéine soluble donc dépourvue de la portion transmembranaire et intracytoplasmique, le récepteur DcR3 est incapable d’effectuer une transduction de signal intracellulaire à la suite de son interaction avec ses ligands. De ce fait, DcR3 joue un rôle de compétiteur pour ces derniers, afin d’inhiber la signalisation via leurs récepteurs fonctionnels tels que Fas, HVEM/LTbetaR et DR3. Lors de nos précédentes études, nous avons pu démontrer, que DcR3 pouvaist moduler la fonction des cellules immunitaires, et aussi protéger la viabilité des îlots de Langerhans. À la suite de ces résultats, nous avons généré des souris DcR3 transgéniques (Tg) en utilisant le promoteur du gène β-actine humaine afin d’étudier plus amplement la fonction de ce récepteur. Les souris Tg DcR3 ont finalement développé le syndrome lupus-like (SLE) seulement après l’âge de 6 mois. Ces souris présentent une variété d'auto-anticorps comprenant des anticorps anti-noyaux et anti-ADN. Elles ont également manifesté des lésions rénales, cutanées, hépatiques et hématopoïétiques. Contrairement aux modèles de lupus murin lpr et gld, les souris DcR3 sont plus proche du SLE humain en terme de réponse immunitaire de type Th2 et de production d'anticorps d'anti-Sm. En péus, nous avons constaté que les cellules hématopoïétiques produisant DcR3 sont suffisantes pour causer ces pathologies. DcR3 peut agir en perturbant l’homéostasie des cellules T pour interférer avec la tolérance périphérique, et ainsi induire l'autoimmunité. Chez l'humain, nous avons détecté dans le sérum de patients SLE des niveaux élevés de la protéine DcR3. Chez certains patients, comme chez la souris, ces niveaux sont liés directement aux titres élevés d’IgE. Par conséquent, DcR3 peut représenter un facteur pathogénique important du SLE humain. L’étude des souris Tg DcR3, nous a permis aussi d’élucider le mécanisme de protection des îlots de Langerhans. Le blocage de la signalisation des ligands LIGHT et TL1A par DcR3 est impliqué dans une telle protection. D'ailleurs, nous avons identifié par ARN microarray quelques molécules en aval de cette interaction, qui peuvent jouer un rôle dans le mécanisme d’action. Nous avons par la suite confirmé que Adcyap1 et Bank1 joue un rôle critique dans la protection des îlots de Langerhans médiée par DcR3. Notre étude a ainsi élucidé le lien qui existe entre la signalisation apoptotique médiée par Fas/FasL et la pathogénèse du SLE humain. Donc, malgré l’absence de mutations génétiques sur Fas et FasL dans le cas de cette pathologie, DcR3 est capable de beoquer cette signalisation et provoquer le SLE chez l’humain. Ainsi, DcR3 peut simultanément interférer avec la signalisation des ligands LIGHT et TL1A et causer un phénotype plus complexe que les phénotypes résultant de la mutation de Fas ou de FasL chez certains patients. DcR3 peut également être utilisé comme paramètre diagnostique potentiel pour le SLE. Les découvertes du mécanisme de protection des îlots de Langerhans par DcR3 ouvrent la porte vers de nouveaux horizons afin d'explorer de nouvelles cibles thérapeutiques pour protéger la greffe d'îlots.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The attached file is created with Scientific Workplace Latex

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le vieillissement vasculaire est caractérisé par une dysfonction de l’endothélium. De nombreux facteurs de risque cardiovasculaire tels que l’obésité et l’hypertension prédisposent l’endothélium à un stress oxydant élevé aboutissant à une dysfonction endothéliale, celle-ci étant communément accompagnée d’une diminution de la biodisponibilité du monoxyde d’azote. Bien que la fonction endothéliale soit un déterminant majeur de la prédiction du risque cardiovasculaire des patients, son évaluation individuelle reste très limitée. En conséquence, il existe un intérêt scientifique grandissant pour la recherche de meilleurs biomarqueurs. L’Angiopoiétine like-2 (angptl2), une protéine identifiée récemment, joue un rôle pro-inflammatoire et pro-oxydant dans plusieurs désordres causés par une inflammation chronique allant de l’obésité à l’athérosclérose. L’inflammation et un stress oxydant accru ont été établis comme des mécanismes sous-jacents à l’apparition d’une dysfonction endothéliale, c’est pourquoi ce travail met l’accent sur le rôle de l’angptl2 dans la dysfonction endothéliale. Plus précisément, ce travail vise à: 1) déterminer les effets aigus de l’angptl2 sur la fonction endothéliale, 2) caractériser la fonction endothéliale et la contribution des différents facteurs relaxants dérivés de l'endothélium (EDRF) dans plusieurs lits vasculaires, et ce, dans un modèle de souris réprimant l’expression de l’angptl2 (knock-down, KD), et 3) examiner si l'absence d'expression angptl2 protège contre la dysfonction endothéliale induite par un régime riche en graisses (HFD) ou par perfusion d'angiotensine II (angII) chez la souris. Dans la première étude, l’incubation aigue avec de l’angptl2 recombinante induit une dysfonction endothéliale dans les artères fémorales isolées de souris de type sauvage (WT), probablement en raison d’une production accrue d'espèces réactives oxygénées. Les artères fémorales de souris angptl2 KD présentent une meilleure fonction endothéliale en comparaison aux souris WT, vraisemblablement par une plus grande contribution de la prostacycline dans la vasodilatation. Après 3 mois d’une diète HFD, les principaux EDRF respectifs des artères fémorales et mésentériques sont conservés uniquement dans les souris angptl2 KD. Cette préservation est associée à un meilleur profil métabolique, une moindre accumulation de triglycérides dans le foie et des adipocytes de plus petite taille. De plus, l’expression de gènes inflammatoires dans ces tissus adipeux n’est augmentée que chez les souris WT. Dans la seconde étude, l’absence d’angptl2 résulte en une production accrue de monoxyde d’azote dans les artères cérébrales isolées par rapport à celles des souris WT. La perfusion chronique d’angII provoque, seulement chez les souris WT, une dysfonction endothéliale cérébrale probablement par le biais d’une augmentation de la production d’espèces réactives oxygénées, probablement dérivé des NADPH oxydase 1 et 2, ainsi que l'augmentation des facteurs constricteurs dérivés de l’endothélium issus de la cyclo-oxygénase. En revanche, l’apocynine réduit la dilatation cérébrale chez les souris KD traitées à l’angII, ce qui suggère le recrutement potentiel d’une voie de signalisation compensatoire impliquant les NADPH oxydases et qui aurait un effet vaso-dilatateur. Ces études suggèrent fortement que l’angptl2 peut avoir un impact direct sur la fonction endothéliale par ses propriétés pro-inflammatoire et pro-oxydante. Dans une optique d’application à la pratique clinique, les niveaux sanguins d’angptl2 pourraient être un bon indicateur de la fonction endothéliale.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The thesis has covered various aspects of modeling and analysis of finite mean time series with symmetric stable distributed innovations. Time series analysis based on Box and Jenkins methods are the most popular approaches where the models are linear and errors are Gaussian. We highlighted the limitations of classical time series analysis tools and explored some generalized tools and organized the approach parallel to the classical set up. In the present thesis we mainly studied the estimation and prediction of signal plus noise model. Here we assumed the signal and noise follow some models with symmetric stable innovations.We start the thesis with some motivating examples and application areas of alpha stable time series models. Classical time series analysis and corresponding theories based on finite variance models are extensively discussed in second chapter. We also surveyed the existing theories and methods correspond to infinite variance models in the same chapter. We present a linear filtering method for computing the filter weights assigned to the observation for estimating unobserved signal under general noisy environment in third chapter. Here we consider both the signal and the noise as stationary processes with infinite variance innovations. We derived semi infinite, double infinite and asymmetric signal extraction filters based on minimum dispersion criteria. Finite length filters based on Kalman-Levy filters are developed and identified the pattern of the filter weights. Simulation studies show that the proposed methods are competent enough in signal extraction for processes with infinite variance.Parameter estimation of autoregressive signals observed in a symmetric stable noise environment is discussed in fourth chapter. Here we used higher order Yule-Walker type estimation using auto-covariation function and exemplify the methods by simulation and application to Sea surface temperature data. We increased the number of Yule-Walker equations and proposed a ordinary least square estimate to the autoregressive parameters. Singularity problem of the auto-covariation matrix is addressed and derived a modified version of the Generalized Yule-Walker method using singular value decomposition.In fifth chapter of the thesis we introduced partial covariation function as a tool for stable time series analysis where covariance or partial covariance is ill defined. Asymptotic results of the partial auto-covariation is studied and its application in model identification of stable auto-regressive models are discussed. We generalize the Durbin-Levinson algorithm to include infinite variance models in terms of partial auto-covariation function and introduce a new information criteria for consistent order estimation of stable autoregressive model.In chapter six we explore the application of the techniques discussed in the previous chapter in signal processing. Frequency estimation of sinusoidal signal observed in symmetric stable noisy environment is discussed in this context. Here we introduced a parametric spectrum analysis and frequency estimate using power transfer function. Estimate of the power transfer function is obtained using the modified generalized Yule-Walker approach. Another important problem in statistical signal processing is to identify the number of sinusoidal components in an observed signal. We used a modified version of the proposed information criteria for this purpose.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Water scarcity and food insecurity are pervasive issues in the developing world and are also intrinsically linked to one another. Through the connection of the water cycle and the carbon cycle this study illustrates that synergistic benefits can be realized by small scale farmers through the implementation of waste water irrigated agroforestry. The WaNuLCAS model is employed using La Huerta agroforestry site in Texcoco, South Central Mexico, as the basis for parameterization. The results of model simulations depicting scenarios of water scarcity and waste water irrigation clearly show that the addition of waste water greatly increases the agroforestry system’s generation of crop yields, above- and below-ground biomass, soil organic matter and carbon storage potential. This increase in carbon sequestration by the system translates into better local food security, diversified household income through payments for ecosystem services and contributes to the mitigation of global climate change.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper examines the strategies and techniques researched and implemented by the International Union for Conservation of Nature (IUCN) in villages in the vicinity of Doi Mae Salong in Chiang Rai Province, Thailand. The strategies revolve around the paradigm linking poverty alleviation, conservation and landscape restoration. IUCN and its partners specifically researched and implemented schemes directed toward diversification of the household economy through alternative and sustainable intensified agriculture techniques based on balancing conservation and livelihood objectives. The projects aimed to reduce poverty and build the resilience of smallholders through decentralised governance arrangements including land use planning schemes and stakeholder negotiation. Considering the agro-ecological system on a catchment-wide scale enhances the conceptual understanding of each component, collectively forming a landscape matrix with requisite benefits for biodiversity, smallholder livelihoods and ecosystem services. In particular, the role of enhancing ecosystem services and functions in building socio-ecological resilience to vulnerabilities such as climate and economic variability is paramount in the process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Low perceptual familiarity with relatively rarer left-handed as opposed to more common right-handed individuals may result in athletes' poorer ability to anticipate the former's action intentions. Part of such left-right asymmetry in visual anticipation could be due to an inefficient gaze strategy during confrontation with left-handed individuals. To exemplify, observers may not mirror their gaze when viewing left- vs. right-handed actions but preferentially fixate on an opponent's right body side, irrespective of an opponent's handedness, owing to the predominant exposure to right-handed actions. So far empirical verification of such assumption, however, is lacking. Here we report on an experiment where team-handball goalkeepers' and non-goalkeepers' gaze behavior was recorded while they predicted throw direction of left- and right-handed 7-m penalties shown as videos on a computer monitor. As expected, goalkeepers were considerably more accurate than non-goalkeepers and prediction was better against right- than left-handed penalties. However, there was no indication of differences in gaze measures (i.e., number of fixations, overall and final fixation duration, time-course of horizontal or vertical fixation deviation) as a function of skill group or the penalty-takers' handedness. Findings suggest that inferior anticipation of left-handed compared to right-handed individuals' action intentions may not be associated with misalignment in gaze behavior. Rather, albeit looking similarly, accuracy differences could be due to observers' differential ability of picking up and interpreting the visual information provided by left- vs. right-handed movements.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

At many locations in Myanmar, ongoing changes in land use have negative environmental impacts and threaten natural ecosystems at local, regional and national scales. In particular, the watershed area of Inle Lake in eastern Myanmar is strongly affected by the environmental effects of deforestation and soil erosion caused by agricultural intensification and expansion of agricultural land, which are exacerbated by the increasing population pressure and the growing number of tourists. This thesis, therefore, focuses on land use changes in traditional farming systems and their effects on socio-economic and biophysical factors to improve our understanding of sustainable natural resource management of this wetland ecosystem. The main objectives of this research were to: (1) assess the noticeable land transformations in space and time, (2) identify the typical farming systems as well as the divergent livelihood strategies, and finally, (3) estimate soil erosion risk in the different agro-ecological zones surrounding the Inle Lake watershed area. GIS and remote sensing techniques allowed to identify the dynamic land use and land cover changes (LUCC) during the past 40 years based on historical Corona images (1968) and Landsat images (1989, 2000 and 2009). In this study, 12 land cover classes were identified and a supervised classification was used for the Landsat datasets, whereas a visual interpretation approach was conducted for the Corona images. Within the past 40 years, the main landscape transformation processes were deforestation (- 49%), urbanization (+ 203%), agricultural expansion (+ 34%) with a notably increase of floating gardens (+ 390%), land abandonment (+ 167%), and marshlands losses in wetland area (- 83%) and water bodies (- 16%). The main driving forces of LUCC appeared to be high population growth, urbanization and settlements, a lack of sustainable land use and environmental management policies, wide-spread rural poverty, an open market economy and changes in market prices and access. To identify the diverse livelihood strategies in the Inle Lake watershed area and the diversity of income generating activities, household surveys were conducted (total: 301 households) using a stratified random sampling design in three different agro-ecological zones: floating gardens (FG), lowland cultivation (LL) and upland cultivation (UP). A cluster and discriminant analysis revealed that livelihood strategies and socio-economic situations of local communities differed significantly in the different zones. For all three zones, different livelihood strategies were identified which differed mainly in the amount of on-farm and off-farm income, and the level of income diversification. The gross margin for each household from agricultural production in the floating garden, lowland and upland cultivation was US$ 2108, 892 and 619 ha-1 respectively. Among the typical farming systems in these zones, tomato (Lycopersicon esculentum L.) plantation in the floating gardens yielded the highest net benefits, but caused negative environmental impacts given the overuse of inorganic fertilizers and pesticides. The Revised Universal Soil Loss Equation (RUSLE) and spatial analysis within GIS were applied to estimate soil erosion risk in the different agricultural zones and for the main cropping systems of the study region. The results revealed that the average soil losses in year 1989, 2000 and 2009 amounted to 20, 10 and 26 t ha-1, respectively and barren land along the steep slopes had the highest soil erosion risk with 85% of the total soil losses in the study area. Yearly fluctuations were mainly caused by changes in the amount of annual precipitation and the dynamics of LUCC such as deforestation and agriculture extension with inappropriate land use and unsustainable cropping systems. Among the typical cropping systems, upland rainfed rice (Oryza sativa L.) cultivation had the highest rate of soil erosion (20 t ha-1yr-1) followed by sebesten (Cordia dichotoma) and turmeric (Curcuma longa) plantation in the UP zone. This study indicated that the hotspot region of soil erosion risk were upland mountain areas, especially in the western part of the Inle lake. Soil conservation practices are thus urgently needed to control soil erosion and lake sedimentation and to conserve the wetland ecosystem. Most farmers have not yet implemented soil conservation measures to reduce soil erosion impacts such as land degradation, sedimentation and water pollution in Inle Lake, which is partly due to the low economic development and poverty in the region. Key challenges of agriculture in the hilly landscapes can be summarized as follows: fostering the sustainable land use of farming systems for the maintenance of ecosystem services and functions while improving the social and economic well-being of the population, integrated natural resources management policies and increasing the diversification of income opportunities to reduce pressure on forest and natural resources.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Soil organic carbon (SOC) plays a vital role in ecosystem function, determining soil fertility, water holding capacity and susceptibility to land degradation. In addition, SOC is related to atmospheric CO, levels with soils having the potential for C release or sequestration, depending on land use, land management and climate. The United Nations Convention on Climate Change and its Kyoto Protocol, and other United Nations Conventions to Combat Desertification and on Biodiversity all recognize the importance of SOC and point to the need for quantification of SOC stocks and changes. An understanding of SOC stocks and changes at the national and regional scale is necessary to further our understanding of the global C cycle, to assess the responses of terrestrial ecosystems to climate change and to aid policy makers in making land use/management decisions. Several studies have considered SOC stocks at the plot scale, but these are site specific and of limited value in making inferences about larger areas. Some studies have used empirical methods to estimate SOC stocks and changes at the regional scale, but such studies are limited in their ability to project future changes, and most have been carried out using temperate data sets. The computational method outlined by the Intergovernmental Panel on Climate Change (IPCC) has been used to estimate SOC stock changes at the regional scale in several studies, including a recent study considering five contrasting eco regions. This 'one step' approach fails to account for the dynamic manner in which SOC changes are likely to occur following changes in land use and land management. A dynamic modelling approach allows estimates to be made in a manner that accounts for the underlying processes leading to SOC change. Ecosystem models, designed for site scale applications can be linked to spatial databases, giving spatially explicit results that allow geographic areas of change in SOC stocks to be identified. Some studies have used variations on this approach to estimate SOC stock changes at the sub-national and national scale for areas of the USA and Europe and at the watershed scale for areas of Mexico and Cuba. However, a need remained for a national and regional scale, spatially explicit system that is generically applicable and can be applied to as wide a range of soil types, climates and land uses as possible. The Global Environment Facility Soil Organic Carbon (GEFSOC) Modelling System was developed in response to this need. The GEFSOC system allows estimates of SOC stocks and changes to be made for diverse conditions, providing essential information for countries wishing to take part in an emerging C market, and bringing us closer to an understanding of the future role of soils in the global C cycle. (C) 2007 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The human gut microbiota comprises a diverse microbial consortium closely co-evolved with the human genome and diet. The importance of the gut microbiota in regulating human health and disease has however been largely overlooked due to the inaccessibility of the intestinal habitat, the complexity of the gut microbiota itself and the fact that many of its members resist cultivation and are in fact new to science. However, with the emergence of 16S rRNA molecular tools and "post-genomics" high resolution technologies for examining microorganisms as they occur in nature without the need for prior laboratory culture, this limited view of the gut microbiota is rapidly changing. This review will discuss the application of molecular microbiological tools to study the human gut microbiota in a culture independent manner. Genomics or metagenomics approaches have a tremendous capability to generate compositional data and to measure the metabolic potential encoded by the combined genomes of the gut microbiota. Another post-genomics approach, metabonomics, has the capacity to measure the metabolic kinetic or flux of metabolites through an ecosystem at a particular point in time or over a time course. Metabonomics thus derives data on the function of the gut microbiota in situ and how it responds to different environmental stimuli e. g. substrates like prebiotics, antibiotics and other drugs and in response to disease. Recently these two culture independent, high resolution approaches have been combined into a single "transgenomic" approach which allows correlation of changes in metabolite profiles within human biofluids with microbiota compositional metagenomic data. Such approaches are providing novel insight into the composition, function and evolution of our gut microbiota.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This report forms part of a larger research programme on 'Reinterpreting the Urban-Rural Continuum', which conceptualises and investigates current knowledge and research gaps concerning 'the role that ecosystems services play in the livelihoods of the poor in regions undergoing rapid change'. The report aims to conduct a baseline appraisal of water-dependant ecosystem services, the roles they play within desakota livelihood systems and their potential sensitivity to climate change. The appraisal is conducted at three spatial scales: global, regional (four consortia areas), and meso scale (case studies within the four regions). At all three scales of analysis water resources form the interweaving theme because water provides a vital provisioning service for people, supports all other ecosystem processes and because water resources are forecast to be severely affected under climate change scenarios. This report, combined with an Endnote library of over 1100 scientific papers, provides an annotated bibliography of water-dependant ecosystem services, the roles they play within desakota livelihood systems and their potential sensitivity to climate change. After an introductory, section, Section 2 of the report defines water-related ecosystem services and how these are affected by human activities. Current knowledge and research gaps are then explored in relation to global scale climate and related hydrological changes (e.g. floods, droughts, flow regimes) (section 3). The report then discusses the impacts of climate changes on the ESPA regions, emphasising potential responses of biomes to the combined effects of climate change and human activities (particularly land use and management), and how these effects coupled with water store and flow regime manipulation by humans may affect the functioning of catchments and their ecosystem services (section 4). Finally, at the meso-scale, case studies are presented from within the ESPA regions to illustrate the close coupling of human activities and catchment performance in the context of environmental change (section 5). At the end of each section, research needs are identified and justified. These research needs are then amalgamated in section 6.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The poliovirus cis-acting replication element (CRE) templates the uridylylation of VPg, the protein primer for genome replication. The CRE is a highly conserved structural RNA element in the enteroviruses and located within the polyprotein-coding region of the genome. We have determined the native structure of the CRE, defined the regions of the structure critical for activity, and investigated the influence of genomic location on function. Our results demonstrate that a 14-nucleotide unpaired terminal loop, presented on a suitably stable stem, is all that is required for function. These conclusions complement the recent analysis of the 14-nucleotide terminal loop in the CRE of human rhinovirus type 14. The CRE can be translocated to the 5' noncoding region of the genome, at least 3.7-kb distant from the native location, without adversely influencing activity, and CRE duplications do not adversely influence replication. We do not have evidence for a specific interaction between the CRE and the RNA-binding 3CD(pro) complex, an essential component of the uridylylation reaction, and the mechanism by which the CRE is coordinated and orientated during the reaction remains unclear. These studies provide a detailed overview of the structural determinants required for CRE function, and will facilitate a better understanding of the requirements for picornavirus replication.