Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Experimental determination of layer cloud edge charging from cosmic ray ionisation

The cloud-air transition zone at stratiform cloud edges is an electrically active region where droplet charging has been predicted. Cloud edge droplet charging is expected from vertical flow of cosmic ray generated atmospheric ions in the global electric circuit. Experimental confirmation of stratiform cloud edge electrification is presented here, through charge and droplet measurements made within an extensive layer of supercooled stratiform cloud, using a specially designed electrostatic sensor. Negative space charge up to 35 pC m−3 was found in a thin (<100 m) layer at the lower cloud boundary associated with the clear air-cloud conductivity gradient, agreeing closely with space charge predicted from the measured droplet concentration using ion-aerosol theory. Such charge levels carried by droplets are sufficient to influence collision processes between cloud droplets.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Small-angle x-ray scattering study of flow alignment of a thermotropic liquid crystal in the nematic and smectic phases

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Synthesis, x-ray structure and anion binding properties of a cryptand-like hybrid calixpyrrole

The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.

Solving surface structures from normal incidence X-ray standing wave data

A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.

Syntheses, x-ray structures, photochemistry, redox properties, and DFT calculations of interconvertible fac- and mer-[Mn(SPS)(CO)3] isomers containing a flexible SPS-based pincer ligand

The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.

Identifying and quantifying nonconservative energy production/destruction terms in hydrostatic Boussinesq primitive equation models

This paper seeks to illustrate the point that physical inconsistencies between thermodynamics and dynamics usually introduce nonconservative production/destruction terms in the local total energy balance equation in numerical ocean general circulation models (OGCMs). Such terms potentially give rise to undesirable forces and/or diabatic terms in the momentum and thermodynamic equations, respectively, which could explain some of the observed errors in simulated ocean currents and water masses. In this paper, a theoretical framework is developed to provide a practical method to determine such nonconservative terms, which is illustrated in the context of a relatively simple form of the hydrostatic Boussinesq primitive equation used in early versions of OGCMs, for which at least four main potential sources of energy nonconservation are identified; they arise from: (1) the “hanging” kinetic energy dissipation term; (2) assuming potential or conservative temperature to be a conservative quantity; (3) the interaction of the Boussinesq approximation with the parameterizations of turbulent mixing of temperature and salinity; (4) some adiabatic compressibility effects due to the Boussinesq approximation. In practice, OGCMs also possess spurious numerical energy sources and sinks, but they are not explicitly addressed here. Apart from (1), the identified nonconservative energy sources/sinks are not sign definite, allowing for possible widespread cancellation when integrated globally. Locally, however, these terms may be of the same order of magnitude as actual energy conversion terms thought to occur in the oceans. Although the actual impact of these nonconservative energy terms on the overall accuracy and physical realism of the oceans is difficult to ascertain, an important issue is whether they could impact on transient simulations, and on the transition toward different circulation regimes associated with a significant reorganization of the different energy reservoirs. Some possible solutions for improvement are examined. It is thus found that the term (2) can be substantially reduced by at least one order of magnitude by using conservative temperature instead of potential temperature. Using the anelastic approximation, however, which was initially thought as a possible way to greatly improve the accuracy of the energy budget, would only marginally reduce the term (4) with no impact on the terms (1), (2) and (3).

The use of trajectory cluster analysis to interpret trace gas measurements at Mace Head, Ireland

A first step in interpreting the wide variation in trace gas concentrations measured over time at a given site is to classify the data according to the prevailing weather conditions. In order to classify measurements made during two intensive field campaigns at Mace Head, on the west coast of Ireland, an objective method of assigning data to different weather types has been developed. Air-mass back trajectories calculated using winds from ECMWF analyses, arriving at the site in 1995–1997, were allocated to clusters based on a statistical analysis of the latitude, longitude and pressure of the trajectory at 12 h intervals over 5 days. The robustness of the analysis was assessed by using an ensemble of back trajectories calculated for four points around Mace Head. Separate analyses were made for each of the 3 years, and for four 3-month periods. The use of these clusters in classifying ground-based ozone measurements at Mace Head is described, including the need to exclude data which have been influenced by local perturbations to the regional flow pattern, for example, by sea breezes. Even with a limited data set, based on 2 months of intensive field measurements in 1996 and 1997, there are statistically significant differences in ozone concentrations in air from the different clusters. The limitations of this type of analysis for classification and interpretation of ground-based chemistry measurements are discussed.

Compact cosmic ray detector for unattended atmospheric ionisation monitoring

Two vertical cosmic ray telescopes for atmospheric cosmic ray ionization event detection are compared. Counter A, designed for low power remote use, was deployed in the Welsh mountains; its event rate increased with altitude as expected from atmospheric cosmic ray absorption. Independently, Counter B’s event rate was found to vary with incoming particle acceptance angle. Simultaneous colocated comparison of both telescopes exposed to atmospheric ionization showed a linear relationship between their event rates.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Assessing the accuracy of CME speed and trajectory estimates from STEREO observations through a comparison of independent methods

We have estimated the speed and direction of propagation of a number of Coronal Mass Ejections (CMEs) using single-spacecraft data from the STEREO Heliospheric Imager (HI) wide-field cameras. In general, these values are in good agreement with those predicted by Thernisien, Vourlidas, and Howard in Solar Phys. 256, 111 -aEuro parts per thousand 130 (2009) using a forward modelling method to fit CMEs imaged by the STEREO COR2 coronagraphs. The directions of the CMEs predicted by both techniques are in good agreement despite the fact that many of the CMEs under study travel in directions that cause them to fade rapidly in the HI images. The velocities estimated from both techniques are in general agreement although there are some interesting differences that may provide evidence for the influence of the ambient solar wind on the speed of CMEs. The majority of CMEs with a velocity estimated to be below 400 km s(-1) in the COR2 field of view have higher estimated velocities in the HI field of view, while, conversely, those with COR2 velocities estimated to be above 400 km s(-1) have lower estimated HI velocities. We interpret this as evidence for the deceleration of fast CMEs and the acceleration of slower CMEs by interaction with the ambient solar wind beyond the COR2 field of view. We also show that the uncertainties in our derived parameters are influenced by the range of elongations over which each CME can be tracked. In order to reduce the uncertainty in the predicted arrival time of a CME at 1 Astronomical Unit (AU) to within six hours, the CME needs to be tracked out to at least 30 degrees elongation. This is in good agreement with predictions of the accuracy of our technique based on Monte Carlo simulations.

A potential lag between the open solar magnetic source flux and solar EUV and X-ray emissions as measured by the Earth's ionosphere during total solar eclipses

Measurements of the ionospheric E-region during total solar eclipses have been used to provide information about the evolution of the solar magnetic field and EUV and X-ray emissions from the solar corona and chromosphere. By measuring levels of ionisation during an eclipse and comparing these measurements with an estimate of the unperturbed ionisation levels (such as those made during a control day, where available) it is possible to estimate the percentage of ionising radiation being emitted by the solar corona and chromosphere. Previously unpublished data from the two eclipses presented here are particularly valuable as they provide information that supplements the data published to date. The eclipse of 23 October 1976 over Australia provides information in a data gap that would otherwise have spanned the years 1966 to 1991. The eclipse of 4 December 2002 over Southern Africa is important as it extends the published sequence of measurements. Comparing measurements from eclipses between 1932 and 2002 with the solar magnetic source flux reveals that changes in the solar EUV and X-ray flux lag the open source flux measurements by approximately 1.5 years. We suggest that this unexpected result comes about from changes to the relative size of the limb corona between eclipses, with the lag representing the time taken to populate the coronal field with plasma hot enough to emit the EUV and X-rays ionising our atmosphere.

Autonomous ship collision free trajectory navigation and control algorithms

A new autonomous ship collision free (ASCF) trajectory navigation and control system has been introduced with a new recursive navigation algorithm based on analytic geometry and convex set theory for ship collision free guidance. The underlying assumption is that the geometric information of ship environment is available in the form of a polygon shaped free space, which may be easily generated from a 2D image or plots relating to physical hazards or other constraints such as collision avoidance regulations. The navigation command is given as a heading command sequence based on generating a way point which falls within a small neighborhood of the current position, and the sequence of the way points along the trajectory are guaranteed to lie within a bounded obstacle free region using convex set theory. A neurofuzzy network predictor which in practice uses only observed input/output data generated by on board sensors or external sensors (or a sensor fusion algorithm), based on using rudder deflection angle for the control of ship heading angle, is utilised in the simulation of an ESSO 190000 dwt tanker model to demonstrate the effectiveness of the system.